Incidental Mutation 'R2421:Vps13a'
ID 249338
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Name vacuolar protein sorting 13A
Synonyms 4930543C13Rik, D330038K10Rik, 4930516E05Rik
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2421 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 16592730-16758297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16737035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 101 (I101L)
Ref Sequence ENSEMBL: ENSMUSP00000153129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068156
AA Change: I101L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: I101L

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224149
AA Change: I101L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225764
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16,729,539 (GRCm39) missense probably damaging 0.98
IGL00537:Vps13a APN 19 16,657,409 (GRCm39) missense probably benign 0.03
IGL00562:Vps13a APN 19 16,712,078 (GRCm39) critical splice donor site probably null
IGL00563:Vps13a APN 19 16,712,078 (GRCm39) critical splice donor site probably null
IGL00579:Vps13a APN 19 16,684,726 (GRCm39) missense probably benign 0.29
IGL00662:Vps13a APN 19 16,681,904 (GRCm39) missense probably damaging 0.96
IGL00667:Vps13a APN 19 16,737,040 (GRCm39) missense probably damaging 1.00
IGL01102:Vps13a APN 19 16,628,781 (GRCm39) critical splice donor site probably null
IGL01139:Vps13a APN 19 16,617,989 (GRCm39) missense probably damaging 0.99
IGL01142:Vps13a APN 19 16,664,479 (GRCm39) missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16,720,371 (GRCm39) missense probably damaging 1.00
IGL01386:Vps13a APN 19 16,678,516 (GRCm39) missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16,739,545 (GRCm39) missense probably damaging 0.98
IGL01700:Vps13a APN 19 16,722,221 (GRCm39) nonsense probably null
IGL01767:Vps13a APN 19 16,641,258 (GRCm39) missense probably damaging 1.00
IGL01782:Vps13a APN 19 16,731,701 (GRCm39) missense probably damaging 0.98
IGL01808:Vps13a APN 19 16,687,650 (GRCm39) missense probably damaging 1.00
IGL01812:Vps13a APN 19 16,692,424 (GRCm39) missense probably benign
IGL01829:Vps13a APN 19 16,596,807 (GRCm39) missense probably benign 0.01
IGL01893:Vps13a APN 19 16,641,139 (GRCm39) missense probably damaging 1.00
IGL02222:Vps13a APN 19 16,659,539 (GRCm39) missense probably benign 0.06
IGL02295:Vps13a APN 19 16,692,406 (GRCm39) splice site probably benign
IGL02465:Vps13a APN 19 16,688,305 (GRCm39) missense probably benign 0.11
IGL02492:Vps13a APN 19 16,625,001 (GRCm39) missense probably damaging 1.00
IGL02581:Vps13a APN 19 16,632,686 (GRCm39) missense probably benign 0.41
IGL02633:Vps13a APN 19 16,697,772 (GRCm39) missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16,676,185 (GRCm39) missense probably benign 0.01
IGL02659:Vps13a APN 19 16,630,063 (GRCm39) missense probably damaging 1.00
IGL02827:Vps13a APN 19 16,618,998 (GRCm39) missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16,641,250 (GRCm39) missense probably damaging 1.00
IGL03057:Vps13a APN 19 16,646,058 (GRCm39) missense probably damaging 1.00
IGL03077:Vps13a APN 19 16,688,246 (GRCm39) missense probably benign
IGL03184:Vps13a APN 19 16,631,734 (GRCm39) missense probably benign 0.00
eggs UTSW 19 16,678,529 (GRCm39) missense probably damaging 1.00
excambio UTSW 19 16,723,311 (GRCm39) splice site probably null
Faster UTSW 19 16,596,849 (GRCm39) missense probably damaging 1.00
Ham UTSW 19 16,655,333 (GRCm39) missense probably benign 0.08
interchange UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16,718,265 (GRCm39) missense probably damaging 1.00
R0045:Vps13a UTSW 19 16,618,174 (GRCm39) nonsense probably null
R0045:Vps13a UTSW 19 16,618,174 (GRCm39) nonsense probably null
R0048:Vps13a UTSW 19 16,653,504 (GRCm39) missense probably damaging 1.00
R0062:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R0062:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R0107:Vps13a UTSW 19 16,669,188 (GRCm39) missense probably benign 0.03
R0135:Vps13a UTSW 19 16,758,129 (GRCm39) missense probably damaging 1.00
R0138:Vps13a UTSW 19 16,637,863 (GRCm39) missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16,655,333 (GRCm39) missense probably benign 0.08
R0359:Vps13a UTSW 19 16,618,941 (GRCm39) missense probably damaging 0.99
R0530:Vps13a UTSW 19 16,632,570 (GRCm39) splice site probably benign
R0541:Vps13a UTSW 19 16,681,941 (GRCm39) missense probably benign 0.00
R0614:Vps13a UTSW 19 16,630,058 (GRCm39) missense probably damaging 1.00
R0685:Vps13a UTSW 19 16,758,105 (GRCm39) missense probably damaging 1.00
R0801:Vps13a UTSW 19 16,664,020 (GRCm39) splice site probably benign
R0835:Vps13a UTSW 19 16,712,246 (GRCm39) splice site probably null
R0848:Vps13a UTSW 19 16,676,261 (GRCm39) missense probably damaging 1.00
R1114:Vps13a UTSW 19 16,727,515 (GRCm39) missense probably benign 0.41
R1205:Vps13a UTSW 19 16,617,905 (GRCm39) missense probably damaging 1.00
R1365:Vps13a UTSW 19 16,596,810 (GRCm39) missense probably damaging 1.00
R1445:Vps13a UTSW 19 16,678,602 (GRCm39) nonsense probably null
R1451:Vps13a UTSW 19 16,688,228 (GRCm39) missense probably benign 0.01
R1479:Vps13a UTSW 19 16,727,478 (GRCm39) splice site probably benign
R1533:Vps13a UTSW 19 16,678,494 (GRCm39) nonsense probably null
R1600:Vps13a UTSW 19 16,643,636 (GRCm39) missense probably benign 0.01
R1870:Vps13a UTSW 19 16,737,316 (GRCm39) missense probably damaging 1.00
R1871:Vps13a UTSW 19 16,642,028 (GRCm39) missense probably benign 0.01
R1959:Vps13a UTSW 19 16,655,302 (GRCm39) missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16,702,995 (GRCm39) missense probably damaging 1.00
R1993:Vps13a UTSW 19 16,699,822 (GRCm39) missense probably benign 0.07
R2257:Vps13a UTSW 19 16,659,538 (GRCm39) missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16,687,790 (GRCm39) missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16,720,421 (GRCm39) missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16,697,817 (GRCm39) missense probably damaging 1.00
R2359:Vps13a UTSW 19 16,630,043 (GRCm39) splice site probably benign
R2847:Vps13a UTSW 19 16,680,963 (GRCm39) missense probably damaging 0.98
R3081:Vps13a UTSW 19 16,642,101 (GRCm39) missense probably benign 0.02
R3522:Vps13a UTSW 19 16,743,857 (GRCm39) splice site probably benign
R3613:Vps13a UTSW 19 16,662,766 (GRCm39) missense probably damaging 1.00
R3797:Vps13a UTSW 19 16,723,311 (GRCm39) splice site probably null
R3874:Vps13a UTSW 19 16,722,317 (GRCm39) missense probably benign 0.01
R4032:Vps13a UTSW 19 16,594,263 (GRCm39) missense probably damaging 1.00
R4111:Vps13a UTSW 19 16,617,992 (GRCm39) missense probably damaging 1.00
R4383:Vps13a UTSW 19 16,678,529 (GRCm39) missense probably damaging 1.00
R4504:Vps13a UTSW 19 16,672,866 (GRCm39) missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16,659,474 (GRCm39) missense probably damaging 0.98
R4587:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4588:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4605:Vps13a UTSW 19 16,617,403 (GRCm39) missense probably damaging 1.00
R4714:Vps13a UTSW 19 16,727,220 (GRCm39) missense probably benign 0.01
R4756:Vps13a UTSW 19 16,632,580 (GRCm39) missense probably benign 0.01
R4831:Vps13a UTSW 19 16,655,356 (GRCm39) missense probably benign 0.04
R5068:Vps13a UTSW 19 16,723,422 (GRCm39) missense probably benign 0.01
R5070:Vps13a UTSW 19 16,631,848 (GRCm39) missense probably benign
R5082:Vps13a UTSW 19 16,722,257 (GRCm39) missense probably damaging 1.00
R5182:Vps13a UTSW 19 16,672,863 (GRCm39) missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16,662,679 (GRCm39) missense probably damaging 1.00
R5283:Vps13a UTSW 19 16,655,334 (GRCm39) missense probably damaging 0.96
R5294:Vps13a UTSW 19 16,619,031 (GRCm39) missense probably damaging 1.00
R5304:Vps13a UTSW 19 16,687,751 (GRCm39) missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16,699,775 (GRCm39) missense probably damaging 1.00
R5592:Vps13a UTSW 19 16,702,935 (GRCm39) missense probably damaging 1.00
R5611:Vps13a UTSW 19 16,702,936 (GRCm39) missense probably damaging 1.00
R5665:Vps13a UTSW 19 16,646,054 (GRCm39) missense probably damaging 1.00
R5671:Vps13a UTSW 19 16,692,464 (GRCm39) missense probably benign 0.03
R5684:Vps13a UTSW 19 16,676,409 (GRCm39) missense probably benign 0.00
R5767:Vps13a UTSW 19 16,641,928 (GRCm39) missense probably damaging 1.00
R5810:Vps13a UTSW 19 16,643,688 (GRCm39) missense probably benign 0.00
R5866:Vps13a UTSW 19 16,657,387 (GRCm39) missense probably benign 0.04
R5886:Vps13a UTSW 19 16,641,926 (GRCm39) missense probably benign 0.01
R5933:Vps13a UTSW 19 16,637,894 (GRCm39) missense probably benign 0.34
R5965:Vps13a UTSW 19 16,596,392 (GRCm39) splice site probably null
R6259:Vps13a UTSW 19 16,664,534 (GRCm39) nonsense probably null
R6346:Vps13a UTSW 19 16,659,578 (GRCm39) missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16,641,382 (GRCm39) missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16,657,414 (GRCm39) missense probably damaging 0.99
R6520:Vps13a UTSW 19 16,702,943 (GRCm39) missense probably damaging 1.00
R6644:Vps13a UTSW 19 16,722,283 (GRCm39) missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16,655,439 (GRCm39) missense probably benign 0.01
R6934:Vps13a UTSW 19 16,653,558 (GRCm39) missense probably damaging 1.00
R6951:Vps13a UTSW 19 16,701,104 (GRCm39) missense probably benign 0.00
R7027:Vps13a UTSW 19 16,642,028 (GRCm39) missense probably benign 0.01
R7126:Vps13a UTSW 19 16,688,243 (GRCm39) missense probably benign
R7206:Vps13a UTSW 19 16,731,662 (GRCm39) missense probably damaging 1.00
R7248:Vps13a UTSW 19 16,655,406 (GRCm39) missense probably benign 0.25
R7252:Vps13a UTSW 19 16,638,428 (GRCm39) missense probably benign 0.00
R7255:Vps13a UTSW 19 16,631,703 (GRCm39) critical splice donor site probably null
R7382:Vps13a UTSW 19 16,596,849 (GRCm39) missense probably damaging 1.00
R7422:Vps13a UTSW 19 16,727,537 (GRCm39) missense probably damaging 1.00
R7425:Vps13a UTSW 19 16,701,066 (GRCm39) missense probably benign 0.13
R7523:Vps13a UTSW 19 16,681,153 (GRCm39) missense probably benign
R7586:Vps13a UTSW 19 16,624,962 (GRCm39) missense probably benign 0.08
R7587:Vps13a UTSW 19 16,681,153 (GRCm39) missense probably benign 0.00
R7593:Vps13a UTSW 19 16,703,027 (GRCm39) missense probably damaging 1.00
R7637:Vps13a UTSW 19 16,727,513 (GRCm39) missense probably benign 0.02
R7763:Vps13a UTSW 19 16,723,364 (GRCm39) missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16,628,820 (GRCm39) missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16,702,936 (GRCm39) missense probably damaging 1.00
R7861:Vps13a UTSW 19 16,632,668 (GRCm39) missense probably damaging 1.00
R7909:Vps13a UTSW 19 16,697,794 (GRCm39) nonsense probably null
R7939:Vps13a UTSW 19 16,718,155 (GRCm39) missense possibly damaging 0.94
R8108:Vps13a UTSW 19 16,618,151 (GRCm39) missense probably damaging 1.00
R8123:Vps13a UTSW 19 16,625,066 (GRCm39) missense probably benign 0.01
R8134:Vps13a UTSW 19 16,631,718 (GRCm39) missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16,726,912 (GRCm39) missense probably benign 0.09
R8272:Vps13a UTSW 19 16,727,209 (GRCm39) critical splice donor site probably null
R8293:Vps13a UTSW 19 16,645,969 (GRCm39) missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16,594,270 (GRCm39) missense probably benign 0.00
R8383:Vps13a UTSW 19 16,701,069 (GRCm39) missense possibly damaging 0.83
R8386:Vps13a UTSW 19 16,678,483 (GRCm39) critical splice donor site probably null
R8433:Vps13a UTSW 19 16,718,600 (GRCm39) missense possibly damaging 0.56
R8436:Vps13a UTSW 19 16,718,157 (GRCm39) missense probably benign 0.10
R8450:Vps13a UTSW 19 16,631,871 (GRCm39) splice site probably null
R8476:Vps13a UTSW 19 16,699,821 (GRCm39) missense possibly damaging 0.60
R8501:Vps13a UTSW 19 16,659,484 (GRCm39) missense probably benign 0.39
R8552:Vps13a UTSW 19 16,731,684 (GRCm39) missense probably damaging 0.99
R8680:Vps13a UTSW 19 16,623,270 (GRCm39) missense possibly damaging 0.84
R8784:Vps13a UTSW 19 16,642,153 (GRCm39) missense probably damaging 1.00
R8871:Vps13a UTSW 19 16,641,186 (GRCm39) missense probably damaging 1.00
R8945:Vps13a UTSW 19 16,642,114 (GRCm39) missense probably damaging 1.00
R8948:Vps13a UTSW 19 16,723,340 (GRCm39) missense probably damaging 0.99
R8950:Vps13a UTSW 19 16,723,340 (GRCm39) missense probably damaging 0.99
R8960:Vps13a UTSW 19 16,683,247 (GRCm39) missense possibly damaging 0.67
R9189:Vps13a UTSW 19 16,663,961 (GRCm39) missense probably benign
R9366:Vps13a UTSW 19 16,672,894 (GRCm39) missense probably damaging 1.00
R9505:Vps13a UTSW 19 16,719,908 (GRCm39) missense possibly damaging 0.94
R9601:Vps13a UTSW 19 16,623,337 (GRCm39) missense possibly damaging 0.84
R9735:Vps13a UTSW 19 16,701,111 (GRCm39) missense probably damaging 1.00
R9776:Vps13a UTSW 19 16,736,958 (GRCm39) missense probably benign
R9796:Vps13a UTSW 19 16,631,828 (GRCm39) missense probably benign 0.01
X0061:Vps13a UTSW 19 16,623,232 (GRCm39) missense probably benign 0.40
X0066:Vps13a UTSW 19 16,719,917 (GRCm39) missense probably benign 0.33
Z1177:Vps13a UTSW 19 16,676,477 (GRCm39) critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16,758,118 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGCTTGTAACATAATCTCAGTAC -3'
(R):5'- CCAGTTGAAGCTGTTTTGGAAG -3'

Sequencing Primer
(F):5'- GTAACATAATCTCAGTACATCCAACC -3'
(R):5'- ACTCATAGTGCCTTCTTCTAGTAAG -3'
Posted On 2014-11-12