Incidental Mutation 'R2421:Smc1a'
ID 249340
Institutional Source Beutler Lab
Gene Symbol Smc1a
Ensembl Gene ENSMUSG00000041133
Gene Name structural maintenance of chromosomes 1A
Synonyms Smc1l1, Smc1, SB1.8, 5830426I24Rik, Smc1alpha, SMCB
MMRRC Submission 040383-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R2421 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 150799386-150844969 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 150830971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045312]
AlphaFold Q9CU62
PDB Structure SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000045312
SMART Domains Protein: ENSMUSP00000044645
Gene: ENSMUSG00000041133

DomainStartEndE-ValueType
Pfam:AAA_29 4 57 6.7e-10 PFAM
Pfam:AAA_23 7 299 8.3e-15 PFAM
low complexity region 347 361 N/A INTRINSIC
SMC_hinge 513 629 5.39e-34 SMART
low complexity region 673 687 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 1045 1061 N/A INTRINSIC
PDB:1W1W|D 1062 1223 2e-40 PDB
Blast:AAA 1070 1222 3e-25 BLAST
SCOP:d1e69a_ 1119 1208 5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131395
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased chromosomal instability, decreased cell survival, and defective S-phase checkpoint after ionizing radiation exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,960,040 (GRCm39) R104H possibly damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adcy10 T A 1: 165,386,166 (GRCm39) L1118Q probably damaging Het
Adgre4 A G 17: 56,085,872 (GRCm39) E57G probably benign Het
Alpk2 T C 18: 65,439,687 (GRCm39) S1036G probably benign Het
Ank3 T C 10: 69,818,034 (GRCm39) probably benign Het
Ankfy1 T A 11: 72,646,722 (GRCm39) probably benign Het
Antxrl A G 14: 33,793,646 (GRCm39) probably benign Het
Apaf1 A T 10: 90,856,585 (GRCm39) V874D probably damaging Het
Arhgap39 T A 15: 76,609,346 (GRCm39) T1025S probably damaging Het
Arhgef12 A T 9: 42,912,302 (GRCm39) C519S probably damaging Het
Aspm G A 1: 139,416,225 (GRCm39) V1512M possibly damaging Het
Atp13a3 T C 16: 30,168,643 (GRCm39) T449A probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Camk2d A G 3: 126,574,064 (GRCm39) D157G probably damaging Het
Ccdc122 T C 14: 77,329,103 (GRCm39) probably benign Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Col4a3 G A 1: 82,647,996 (GRCm39) probably benign Het
Coq10b G A 1: 55,092,136 (GRCm39) A35T probably benign Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Creb3l3 T C 10: 80,927,652 (GRCm39) I47V probably benign Het
Csgalnact1 A T 8: 68,914,160 (GRCm39) I15N probably benign Het
Dcp1b A G 6: 119,192,227 (GRCm39) Q381R probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Dnal1 C T 12: 84,183,480 (GRCm39) Q80* probably null Het
Dtd2 A G 12: 52,046,638 (GRCm39) V67A probably benign Het
Gart A G 16: 91,439,928 (GRCm39) probably null Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,577,958 (GRCm39) noncoding transcript Het
Gm8674 T C 13: 50,054,699 (GRCm39) noncoding transcript Het
Gpr107 G A 2: 31,075,541 (GRCm39) G351S probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lenep G A 3: 89,309,881 (GRCm39) probably null Het
Lrp1b T C 2: 40,772,145 (GRCm39) probably benign Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Lyn C T 4: 3,748,787 (GRCm39) A255V possibly damaging Het
Mdn1 T A 4: 32,723,621 (GRCm39) I2519K probably damaging Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Ms4a4b A G 19: 11,432,061 (GRCm39) I61V possibly damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or13a1 T A 6: 116,470,674 (GRCm39) C35S probably benign Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5k8 T C 16: 58,644,709 (GRCm39) D121G probably damaging Het
Pef1 C A 4: 130,021,110 (GRCm39) C221* probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Pnliprp1 T A 19: 58,732,517 (GRCm39) I460N probably benign Het
Ppfia4 T C 1: 134,255,138 (GRCm39) N239S probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Prlr T A 15: 10,319,343 (GRCm39) W91R probably damaging Het
Psmd2 T A 16: 20,478,856 (GRCm39) probably null Het
Ptprt T A 2: 162,119,960 (GRCm39) probably benign Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Rbm12b2 T C 4: 12,095,127 (GRCm39) F662S possibly damaging Het
Rgs6 C A 12: 83,163,057 (GRCm39) T421K possibly damaging Het
Ryr2 T G 13: 11,606,123 (GRCm39) Q4486H probably damaging Het
Scn7a A T 2: 66,556,646 (GRCm39) probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Syt9 G A 7: 107,035,988 (GRCm39) R335K probably benign Het
Taar7a T C 10: 23,868,415 (GRCm39) N322S probably damaging Het
Tfb2m C A 1: 179,361,231 (GRCm39) W252C possibly damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyw1 A T 5: 130,298,101 (GRCm39) H214L probably damaging Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vangl2 T C 1: 171,835,526 (GRCm39) Y382C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Vps13a T G 19: 16,737,035 (GRCm39) I101L probably benign Het
Washc4 T A 10: 83,415,385 (GRCm39) F792I probably damaging Het
Wdhd1 G A 14: 47,496,041 (GRCm39) H608Y probably benign Het
Wdr48 T A 9: 119,731,470 (GRCm39) I56K probably damaging Het
Xpo4 T C 14: 57,866,960 (GRCm39) D194G probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp821 T A 8: 110,436,165 (GRCm39) probably null Het
Zswim8 A G 14: 20,769,525 (GRCm39) Y1237C probably damaging Het
Other mutations in Smc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Smc1a APN X 150,819,125 (GRCm39) missense probably damaging 1.00
IGL02385:Smc1a APN X 150,820,655 (GRCm39) missense possibly damaging 0.67
R2422:Smc1a UTSW X 150,830,971 (GRCm39) splice site probably benign
R2939:Smc1a UTSW X 150,816,695 (GRCm39) missense probably damaging 1.00
R2940:Smc1a UTSW X 150,816,695 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATCTAGCAAAGGAGTTCC -3'
(R):5'- CCTGTGGGACCAATTGTAGAG -3'

Sequencing Primer
(F):5'- GGAGTTCCTAATCTCTAGAGGGATAC -3'
(R):5'- CCTGTGGGACCAATTGTAGAGATAGC -3'
Posted On 2014-11-12