Mutagenetix > Incidental Mutation

Incidental Mutation 'R2421:Smc1a'

249340

Institutional Source

Beutler Lab

Gene Symbol

Smc1a

Ensembl Gene

ENSMUSG00000041133

Gene Name

structural maintenance of chromosomes 1A

Synonyms

Smc1alpha, SB1.8, 5830426I24Rik, Smc1l1, Smc1, SMCB

MMRRC Submission

040383-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R2421 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

152016428-152062694 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 152047975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045312]

AlphaFold

Q9CU62

PDB Structure

SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000045312

SMART Domains

Protein: ENSMUSP00000044645
Gene: ENSMUSG00000041133

Domain	Start	End	E-Value	Type
Pfam:AAA_29	4	57	6.7e-10	PFAM
Pfam:AAA_23	7	299	8.3e-15	PFAM
low complexity region	347	361	N/A	INTRINSIC
SMC_hinge	513	629	5.39e-34	SMART
low complexity region	673	687	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	1045	1061	N/A	INTRINSIC
PDB:1W1W\|D	1062	1223	2e-40	PDB
Blast:AAA	1070	1222	3e-25	BLAST
SCOP:d1e69a_	1119	1208	5e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131395

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased chromosomal instability, decreased cell survival, and defective S-phase checkpoint after ionizing radiation exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	C	5: 5,455,912	Y123C	probably benign	Het
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
Abraxas1	C	T	5: 100,812,174	R104H	possibly damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adcy10	T	A	1: 165,558,597	L1118Q	probably damaging	Het
Adgre4	A	G	17: 55,778,872	E57G	probably benign	Het
Alpk2	T	C	18: 65,306,616	S1036G	probably benign	Het
Ank3	T	C	10: 69,982,204		probably benign	Het
Ankfy1	T	A	11: 72,755,896		probably benign	Het
Antxrl	A	G	14: 34,071,689		probably benign	Het
Apaf1	A	T	10: 91,020,723	V874D	probably damaging	Het
Arhgap39	T	A	15: 76,725,146	T1025S	probably damaging	Het
Arhgef12	A	T	9: 43,001,006	C519S	probably damaging	Het
Aspm	G	A	1: 139,488,487	V1512M	possibly damaging	Het
Atp13a3	T	C	16: 30,349,825	T449A	probably benign	Het
Atxn2	A	T	5: 121,802,079		probably null	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Camk2d	A	G	3: 126,780,415	D157G	probably damaging	Het
Ccdc122	T	C	14: 77,091,663		probably benign	Het
Ccdc137	G	A	11: 120,462,264		probably null	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Col4a3	G	A	1: 82,670,275		probably benign	Het
Coq10b	G	A	1: 55,052,977	A35T	probably benign	Het
Creb3l3	T	C	10: 81,091,818	I47V	probably benign	Het
Csgalnact1	A	T	8: 68,461,508	I15N	probably benign	Het
Dcp1b	A	G	6: 119,215,266	Q381R	probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Dnal1	C	T	12: 84,136,706	Q80*	probably null	Het
Dtd2	A	G	12: 51,999,855	V67A	probably benign	Het
Gart	A	G	16: 91,643,040		probably null	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm6327	T	C	16: 12,760,094		noncoding transcript	Het
Gm8674	T	C	13: 49,900,663		noncoding transcript	Het
Gpr107	G	A	2: 31,185,529	G351S	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Krt13	A	T	11: 100,120,051	L159Q	probably benign	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lenep	G	A	3: 89,402,574		probably null	Het
Lrp1b	T	C	2: 40,882,133		probably benign	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Lyn	C	T	4: 3,748,787	A255V	possibly damaging	Het
Mdn1	T	A	4: 32,723,621	I2519K	probably damaging	Het
Mmaa	T	A	8: 79,281,432	R59W	probably damaging	Het
Ms4a4b	A	G	19: 11,454,697	I61V	possibly damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Olfr1219	T	C	2: 89,074,992	Y33C	possibly damaging	Het
Olfr175-ps1	T	C	16: 58,824,346	D121G	probably damaging	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr211	T	A	6: 116,493,713	C35S	probably benign	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pef1	C	A	4: 130,127,317	C221*	probably null	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Pnliprp1	T	A	19: 58,744,085	I460N	probably benign	Het
Ppfia4	T	C	1: 134,327,400	N239S	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Prlr	T	A	15: 10,319,257	W91R	probably damaging	Het
Psmd2	T	A	16: 20,660,106		probably null	Het
Ptprt	T	A	2: 162,278,040		probably benign	Het
Rbm12b2	T	C	4: 12,095,127	F662S	possibly damaging	Het
Rgs6	C	A	12: 83,116,283	T421K	possibly damaging	Het
Ryr2	T	G	13: 11,591,237	Q4486H	probably damaging	Het
Scn7a	A	T	2: 66,726,302		probably benign	Het
Synrg	A	G	11: 84,009,224	E674G	probably damaging	Het
Syt9	G	A	7: 107,436,781	R335K	probably benign	Het
Taar7a	T	C	10: 23,992,517	N322S	probably damaging	Het
Tfb2m	C	A	1: 179,533,666	W252C	possibly damaging	Het
Tmub2	T	A	11: 102,287,755	D161E	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw1	A	T	5: 130,269,260	H214L	probably damaging	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vangl2	T	C	1: 172,007,959	Y382C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Vps13a	T	G	19: 16,759,671	I101L	probably benign	Het
Washc4	T	A	10: 83,579,521	F792I	probably damaging	Het
Wdhd1	G	A	14: 47,258,584	H608Y	probably benign	Het
Wdr48	T	A	9: 119,902,404	I56K	probably damaging	Het
Xpo4	T	C	14: 57,629,503	D194G	probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp821	T	A	8: 109,709,533		probably null	Het
Zswim8	A	G	14: 20,719,457	Y1237C	probably damaging	Het

Other mutations in Smc1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Smc1a	APN	X	152036129	missense	probably damaging	1.00
IGL02385:Smc1a	APN	X	152037659	missense	possibly damaging	0.67
R2422:Smc1a	UTSW	X	152047975	splice site	probably benign
R2939:Smc1a	UTSW	X	152033699	missense	probably damaging	1.00
R2940:Smc1a	UTSW	X	152033699	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCATCTAGCAAAGGAGTTCC -3'
(R):5'- CCTGTGGGACCAATTGTAGAG -3'

Sequencing Primer
(F):5'- GGAGTTCCTAATCTCTAGAGGGATAC -3'
(R):5'- CCTGTGGGACCAATTGTAGAGATAGC -3'

Posted On

2014-11-12