Incidental Mutation 'R2422:Ugcg'
ID249359
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2422 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
congee UTSW 4 59207798 missense probably benign 0.17
Porridge UTSW 4 59219530 missense possibly damaging 0.86
slop UTSW 4 59211883 missense probably benign 0.16
wheatina UTSW 4 59220272 missense probably damaging 0.96
PIT4382001:Ugcg UTSW 4 59213246 missense possibly damaging 0.68
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
R7194:Ugcg UTSW 4 59213210 missense probably damaging 0.99
R7286:Ugcg UTSW 4 59217111 missense possibly damaging 0.95
R7362:Ugcg UTSW 4 59217109 missense probably damaging 1.00
R7472:Ugcg UTSW 4 59217156 missense probably benign
R7638:Ugcg UTSW 4 59220299 missense probably benign 0.26
R7866:Ugcg UTSW 4 59211927 missense possibly damaging 0.71
R8170:Ugcg UTSW 4 59211974 missense possibly damaging 0.71
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'
Posted On2014-11-12