Incidental Mutation 'R2422:Zfp638'
ID 249371
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Name zinc finger protein 638
Synonyms Np220, Zfml
MMRRC Submission 040384-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R2422 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 83844050-83963855 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 83943421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000204751] [ENSMUST00000203891]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032088
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113836
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203324
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203481
Predicted Effect probably benign
Transcript: ENSMUST00000204751
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204120
Predicted Effect probably benign
Transcript: ENSMUST00000205166
Predicted Effect probably benign
Transcript: ENSMUST00000203891
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204953
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,421,864 (GRCm39) N47I probably benign Het
Actr5 T C 2: 158,478,001 (GRCm39) F457S probably damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adck2 C T 6: 39,560,932 (GRCm39) A440V possibly damaging Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc121rt3 A T 5: 112,502,984 (GRCm39) V240D probably damaging Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Ccdc77 A G 6: 120,316,120 (GRCm39) C186R probably benign Het
Cdk12 T G 11: 98,109,900 (GRCm39) S640R probably benign Het
Cdv3 T C 9: 103,242,317 (GRCm39) probably benign Het
Celf2 G A 2: 6,558,700 (GRCm39) T364I probably damaging Het
Cmtr2 C A 8: 110,949,413 (GRCm39) S574R probably benign Het
Col14a1 T C 15: 55,313,318 (GRCm39) L56P unknown Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Dctn1 C T 6: 83,176,782 (GRCm39) L1241F possibly damaging Het
Depdc5 T C 5: 33,148,379 (GRCm39) F1505S probably damaging Het
Dhcr24 G T 4: 106,418,291 (GRCm39) probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Entpd7 A T 19: 43,716,527 (GRCm39) Y507F possibly damaging Het
Fbp1 T C 13: 63,019,120 (GRCm39) K24E probably benign Het
Galr1 A T 18: 82,424,048 (GRCm39) N76K probably damaging Het
Glrb A G 3: 80,767,542 (GRCm39) I226T probably damaging Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm4950 T A 18: 51,998,856 (GRCm39) Q33L probably benign Het
Gnat2 A T 3: 108,002,855 (GRCm39) M88L probably damaging Het
Gpr183 A G 14: 122,191,589 (GRCm39) Y311H probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Hipk3 C T 2: 104,301,830 (GRCm39) G121R probably benign Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Homez C A 14: 55,095,031 (GRCm39) V226F probably benign Het
Inf2 C A 12: 112,577,258 (GRCm39) A1034D unknown Het
Kcnc4 G T 3: 107,352,863 (GRCm39) P572T probably benign Het
Kmt2d T C 15: 98,760,147 (GRCm39) E1037G unknown Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lmbrd2 C T 15: 9,194,852 (GRCm39) T618M possibly damaging Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Mettl22 T C 16: 8,305,225 (GRCm39) F293L probably damaging Het
Mib1 T C 18: 10,751,906 (GRCm39) S263P probably damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Nek1 T C 8: 61,472,935 (GRCm39) V152A probably damaging Het
Nlrp4d T A 7: 10,096,872 (GRCm39) D876V probably benign Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or11g7 T C 14: 50,690,893 (GRCm39) L128P probably damaging Het
Or5an11 A T 19: 12,246,283 (GRCm39) T230S probably damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Pcdha11 G T 18: 37,140,325 (GRCm39) L651F probably damaging Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Plxnb1 G A 9: 108,937,506 (GRCm39) R1169H probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Pum2 A T 12: 8,798,931 (GRCm39) Q930L possibly damaging Het
Rbp4 T C 19: 38,112,792 (GRCm39) E67G probably damaging Het
Rgs9 C A 11: 109,116,603 (GRCm39) probably null Het
Semp2l1 C T 1: 32,584,942 (GRCm39) A323T possibly damaging Het
Sipa1 A T 19: 5,702,140 (GRCm39) D923E possibly damaging Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Snx33 C A 9: 56,825,822 (GRCm39) M546I probably benign Het
Spag17 T A 3: 99,934,935 (GRCm39) W714R probably benign Het
Spata2 C T 2: 167,326,126 (GRCm39) R231Q probably damaging Het
Stard9 C T 2: 120,530,765 (GRCm39) R2341C probably benign Het
Tas2r116 A T 6: 132,832,557 (GRCm39) I53F possibly damaging Het
Tlk1 T C 2: 70,600,349 (GRCm39) E110G probably damaging Het
Tmem102 T A 11: 69,695,363 (GRCm39) E203V probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Wdr77 A T 3: 105,867,337 (GRCm39) K62* probably null Het
Zfhx4 C A 3: 5,455,465 (GRCm39) A1153E probably benign Het
Zfp266 C A 9: 20,410,558 (GRCm39) V540L possibly damaging Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp951 G A 5: 104,963,143 (GRCm39) T141I probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83,956,700 (GRCm39) missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83,933,680 (GRCm39) missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83,954,112 (GRCm39) missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83,906,146 (GRCm39) missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83,911,976 (GRCm39) missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83,921,780 (GRCm39) missense probably benign 0.01
IGL01570:Zfp638 APN 6 83,924,829 (GRCm39) missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83,956,508 (GRCm39) missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83,961,857 (GRCm39) missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83,946,214 (GRCm39) missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83,961,866 (GRCm39) missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83,912,000 (GRCm39) splice site probably benign
IGL03135:Zfp638 APN 6 83,919,857 (GRCm39) missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83,923,229 (GRCm39) missense probably benign 0.04
R0190:Zfp638 UTSW 6 83,905,946 (GRCm39) missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83,944,336 (GRCm39) missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83,949,220 (GRCm39) unclassified probably benign
R0938:Zfp638 UTSW 6 83,961,023 (GRCm39) missense probably benign 0.16
R1312:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83,921,638 (GRCm39) missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83,955,047 (GRCm39) splice site probably null
R1634:Zfp638 UTSW 6 83,956,894 (GRCm39) splice site probably null
R1651:Zfp638 UTSW 6 83,931,719 (GRCm39) missense probably benign 0.00
R2079:Zfp638 UTSW 6 83,930,371 (GRCm39) critical splice donor site probably null
R2134:Zfp638 UTSW 6 83,905,964 (GRCm39) missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83,963,578 (GRCm39) missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83,906,500 (GRCm39) missense probably damaging 1.00
R4353:Zfp638 UTSW 6 83,961,041 (GRCm39) missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83,958,719 (GRCm39) missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83,956,544 (GRCm39) nonsense probably null
R4807:Zfp638 UTSW 6 83,920,040 (GRCm39) missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83,956,457 (GRCm39) missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83,906,438 (GRCm39) missense probably benign 0.03
R5236:Zfp638 UTSW 6 83,953,557 (GRCm39) nonsense probably null
R5323:Zfp638 UTSW 6 83,939,076 (GRCm39) missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83,953,396 (GRCm39) missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83,944,345 (GRCm39) missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83,956,170 (GRCm39) missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83,906,623 (GRCm39) missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83,920,111 (GRCm39) missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83,906,969 (GRCm39) missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83,906,054 (GRCm39) missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83,921,829 (GRCm39) missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83,954,047 (GRCm39) missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83,844,212 (GRCm39) missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83,942,560 (GRCm39) missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83,907,092 (GRCm39) missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83,930,108 (GRCm39) missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83,931,708 (GRCm39) missense probably benign 0.00
R7141:Zfp638 UTSW 6 83,844,181 (GRCm39) missense unknown
R7368:Zfp638 UTSW 6 83,906,437 (GRCm39) missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83,905,670 (GRCm39) missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83,907,127 (GRCm39) missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83,953,254 (GRCm39) missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83,956,196 (GRCm39) missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83,906,801 (GRCm39) missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83,954,391 (GRCm39) missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83,906,713 (GRCm39) missense possibly damaging 0.85
R8327:Zfp638 UTSW 6 83,905,679 (GRCm39) missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83,956,747 (GRCm39) missense probably benign 0.28
R8703:Zfp638 UTSW 6 83,954,143 (GRCm39) missense probably damaging 0.96
R8738:Zfp638 UTSW 6 83,931,745 (GRCm39) critical splice donor site probably null
R8865:Zfp638 UTSW 6 83,954,035 (GRCm39) missense possibly damaging 0.91
R8874:Zfp638 UTSW 6 83,946,135 (GRCm39) missense probably damaging 1.00
R9080:Zfp638 UTSW 6 83,844,155 (GRCm39) missense unknown
R9113:Zfp638 UTSW 6 83,953,894 (GRCm39) missense probably damaging 0.96
R9574:Zfp638 UTSW 6 83,956,680 (GRCm39) missense probably damaging 1.00
R9661:Zfp638 UTSW 6 83,923,320 (GRCm39) missense probably damaging 0.99
R9722:Zfp638 UTSW 6 83,923,301 (GRCm39) missense probably damaging 1.00
R9745:Zfp638 UTSW 6 83,921,795 (GRCm39) missense probably benign 0.27
Z1088:Zfp638 UTSW 6 83,921,793 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGTCATCCTAACTTGTTAGC -3'
(R):5'- AAGGACTATGATACCCTTTCCG -3'

Sequencing Primer
(F):5'- TCCTAACTTGTTAGCAATAGTAGGG -3'
(R):5'- CCAAGAACCATCTAATATCTCAG -3'
Posted On 2014-11-12