Mutagenetix > Incidental Mutation

Incidental Mutation 'R2422:Nek1'

249375

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

040384-MU

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2422 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61019901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 152 (V152A)

Ref Sequence

ENSEMBL: ENSMUSP00000147258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

AlphaFold

P51954

Predicted Effect

probably damaging
Transcript: ENSMUST00000034065
AA Change: V152A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: V152A

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120689
AA Change: V152A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: V152A

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210310

Predicted Effect

probably damaging
Transcript: ENSMUST00000211256
AA Change: V152A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211672
AA Change: V152A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1860

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
4933409G03Rik	A	T	2: 68,591,520	N47I	probably benign	Het
Actr5	T	C	2: 158,636,081	F457S	probably damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adck2	C	T	6: 39,583,998	A440V	possibly damaging	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Ccdc77	A	G	6: 120,339,159	C186R	probably benign	Het
Cdk12	T	G	11: 98,219,074	S640R	probably benign	Het
Cdv3	T	C	9: 103,365,118		probably benign	Het
Celf2	G	A	2: 6,553,889	T364I	probably damaging	Het
Cmtr2	C	A	8: 110,222,781	S574R	probably benign	Het
Col14a1	T	C	15: 55,449,922	L56P	unknown	Het
Dctn1	C	T	6: 83,199,800	L1241F	possibly damaging	Het
Depdc5	T	C	5: 32,991,035	F1505S	probably damaging	Het
Dhcr24	G	T	4: 106,561,094		probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Entpd7	A	T	19: 43,728,088	Y507F	possibly damaging	Het
Fbp1	T	C	13: 62,871,306	K24E	probably benign	Het
Galr1	A	T	18: 82,405,923	N76K	probably damaging	Het
Glrb	A	G	3: 80,860,235	I226T	probably damaging	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm4950	T	A	18: 51,865,784	Q33L	probably benign	Het
Gm5415	C	T	1: 32,545,861	A323T	possibly damaging	Het
Gm6583	A	T	5: 112,355,118	V240D	probably damaging	Het
Gnat2	A	T	3: 108,095,539	M88L	probably damaging	Het
Gpr183	A	G	14: 121,954,177	Y311H	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Hipk3	C	T	2: 104,471,485	G121R	probably benign	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homez	C	A	14: 54,857,574	V226F	probably benign	Het
Inf2	C	A	12: 112,610,824	A1034D	unknown	Het
Kcnc4	G	T	3: 107,445,547	P572T	probably benign	Het
Kmt2d	T	C	15: 98,862,266	E1037G	unknown	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lmbrd2	C	T	15: 9,194,765	T618M	possibly damaging	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Mettl22	T	C	16: 8,487,361	F293L	probably damaging	Het
Mib1	T	C	18: 10,751,906	S263P	probably damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Nlrp4d	T	A	7: 10,362,945	D876V	probably benign	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr235	A	T	19: 12,268,919	T230S	probably damaging	Het
Olfr740	T	C	14: 50,453,436	L128P	probably damaging	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pcdha11	G	T	18: 37,007,272	L651F	probably damaging	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Plxnb1	G	A	9: 109,108,438	R1169H	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Pum2	A	T	12: 8,748,931	Q930L	possibly damaging	Het
Rbp4	T	C	19: 38,124,344	E67G	probably damaging	Het
Rgs9	C	A	11: 109,225,777		probably null	Het
Sipa1	A	T	19: 5,652,112	D923E	possibly damaging	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Snx33	C	A	9: 56,918,538	M546I	probably benign	Het
Spag17	T	A	3: 100,027,619	W714R	probably benign	Het
Spata2	C	T	2: 167,484,206	R231Q	probably damaging	Het
Stard9	C	T	2: 120,700,284	R2341C	probably benign	Het
Tas2r116	A	T	6: 132,855,594	I53F	possibly damaging	Het
Tlk1	T	C	2: 70,770,005	E110G	probably damaging	Het
Tmem102	T	A	11: 69,804,537	E203V	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Wdr77	A	T	3: 105,960,021	K62*	probably null	Het
Zfhx4	C	A	3: 5,390,405	A1153E	probably benign	Het
Zfp266	C	A	9: 20,499,262	V540L	possibly damaging	Het
Zfp638	C	A	6: 83,966,439		probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp951	G	A	5: 104,815,277	T141I	probably benign	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	splice site	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	splice site	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
R7984:Nek1	UTSW	8	61121053	nonsense	probably null
R8271:Nek1	UTSW	8	61105612	missense	probably benign	0.04
R8431:Nek1	UTSW	8	61034032	missense	possibly damaging	0.95
R9076:Nek1	UTSW	8	61028734	missense	probably damaging	0.96
R9149:Nek1	UTSW	8	61121021	missense	probably damaging	1.00
R9250:Nek1	UTSW	8	61012117	missense	probably damaging	0.99
R9429:Nek1	UTSW	8	61106858	missense	probably benign
R9563:Nek1	UTSW	8	61124123	missense	probably benign	0.36
R9616:Nek1	UTSW	8	61020073	missense	probably damaging	0.99
RF023:Nek1	UTSW	8	61072745	splice site	probably null
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGGGGATCTGAACTTTAGATCTC -3'
(R):5'- TGCCTATGCAAGTTCGAGCC -3'

Sequencing Primer
(F):5'- CATGGGGATATCCAGCTATTCCAG -3'
(R):5'- GTTCGAGCCAGCTCTACAGTACTAG -3'

Posted On

2014-11-12