Mutagenetix > Incidental Mutation

Incidental Mutation 'R2422:Plxnb1'

249382

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

MMRRC Submission

040384-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2422 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 109108438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1169 (R1169H)

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072093]

AlphaFold

Q8CJH3

Predicted Effect

probably benign
Transcript: ENSMUST00000072093
AA Change: R1169H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: R1169H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192117

Predicted Effect

unknown
Transcript: ENSMUST00000192988
AA Change: R203H

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195364

Meta Mutation Damage Score

0.0856

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
4933409G03Rik	A	T	2: 68,591,520	N47I	probably benign	Het
Actr5	T	C	2: 158,636,081	F457S	probably damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adck2	C	T	6: 39,583,998	A440V	possibly damaging	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Ccdc77	A	G	6: 120,339,159	C186R	probably benign	Het
Cdk12	T	G	11: 98,219,074	S640R	probably benign	Het
Cdv3	T	C	9: 103,365,118		probably benign	Het
Celf2	G	A	2: 6,553,889	T364I	probably damaging	Het
Cmtr2	C	A	8: 110,222,781	S574R	probably benign	Het
Col14a1	T	C	15: 55,449,922	L56P	unknown	Het
Dctn1	C	T	6: 83,199,800	L1241F	possibly damaging	Het
Depdc5	T	C	5: 32,991,035	F1505S	probably damaging	Het
Dhcr24	G	T	4: 106,561,094		probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Entpd7	A	T	19: 43,728,088	Y507F	possibly damaging	Het
Fbp1	T	C	13: 62,871,306	K24E	probably benign	Het
Galr1	A	T	18: 82,405,923	N76K	probably damaging	Het
Glrb	A	G	3: 80,860,235	I226T	probably damaging	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm4950	T	A	18: 51,865,784	Q33L	probably benign	Het
Gm5415	C	T	1: 32,545,861	A323T	possibly damaging	Het
Gm6583	A	T	5: 112,355,118	V240D	probably damaging	Het
Gnat2	A	T	3: 108,095,539	M88L	probably damaging	Het
Gpr183	A	G	14: 121,954,177	Y311H	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Hipk3	C	T	2: 104,471,485	G121R	probably benign	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homez	C	A	14: 54,857,574	V226F	probably benign	Het
Inf2	C	A	12: 112,610,824	A1034D	unknown	Het
Kcnc4	G	T	3: 107,445,547	P572T	probably benign	Het
Kmt2d	T	C	15: 98,862,266	E1037G	unknown	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lmbrd2	C	T	15: 9,194,765	T618M	possibly damaging	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Mettl22	T	C	16: 8,487,361	F293L	probably damaging	Het
Mib1	T	C	18: 10,751,906	S263P	probably damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Nek1	T	C	8: 61,019,901	V152A	probably damaging	Het
Nlrp4d	T	A	7: 10,362,945	D876V	probably benign	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr235	A	T	19: 12,268,919	T230S	probably damaging	Het
Olfr740	T	C	14: 50,453,436	L128P	probably damaging	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pcdha11	G	T	18: 37,007,272	L651F	probably damaging	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Pum2	A	T	12: 8,748,931	Q930L	possibly damaging	Het
Rbp4	T	C	19: 38,124,344	E67G	probably damaging	Het
Rgs9	C	A	11: 109,225,777		probably null	Het
Sipa1	A	T	19: 5,652,112	D923E	possibly damaging	Het
Smc1a	A	G	X: 152,047,975		probably benign	Het
Snx33	C	A	9: 56,918,538	M546I	probably benign	Het
Spag17	T	A	3: 100,027,619	W714R	probably benign	Het
Spata2	C	T	2: 167,484,206	R231Q	probably damaging	Het
Stard9	C	T	2: 120,700,284	R2341C	probably benign	Het
Tas2r116	A	T	6: 132,855,594	I53F	possibly damaging	Het
Tlk1	T	C	2: 70,770,005	E110G	probably damaging	Het
Tmem102	T	A	11: 69,804,537	E203V	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Wdr77	A	T	3: 105,960,021	K62*	probably null	Het
Zfhx4	C	A	3: 5,390,405	A1153E	probably benign	Het
Zfp266	C	A	9: 20,499,262	V540L	possibly damaging	Het
Zfp638	C	A	6: 83,966,439		probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp951	G	A	5: 104,815,277	T141I	probably benign	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R1936:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4796:Plxnb1	UTSW	9	109114595	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5431:Plxnb1	UTSW	9	109100772	missense	probably damaging	1.00
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6020:Plxnb1	UTSW	9	109116611	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6734:Plxnb1	UTSW	9	109108920	nonsense	probably null
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
R8987:Plxnb1	UTSW	9	109108110	splice site	probably benign
R9176:Plxnb1	UTSW	9	109112583	missense	probably damaging	1.00
R9231:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.59
R9698:Plxnb1	UTSW	9	109096183	start gained	probably benign
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GGTGCCTGAACGCTAAACAAAC -3'
(R):5'- TGGGGCAGACTAAACCACTC -3'

Sequencing Primer
(F):5'- GCTAAACAAACCCAGCTGCCTG -3'
(R):5'- GACTAAACCACTCCACGCTGG -3'

Posted On

2014-11-12