Incidental Mutation 'R2422:Rgs9'
ID 249386
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Name regulator of G-protein signaling 9
Synonyms Rgs9-2, RGS9-1
MMRRC Submission 040384-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2422 (G1)
Quality Score 223
Status Validated
Chromosome 11
Chromosomal Location 109225355-109298129 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to A at 109225777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000103062]
AlphaFold O54828
Predicted Effect probably null
Transcript: ENSMUST00000020920
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103062
SMART Domains Protein: ENSMUSP00000099351
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
G_gamma 1 54 2.27e-6 SMART
GGL 1 54 1.86e-15 SMART
RGS 73 188 4.47e-48 SMART
low complexity region 260 278 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Entpd7 A T 19: 43,728,088 Y507F possibly damaging Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1499:Rgs9 UTSW 11 109268921 critical splice donor site probably null
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5209:Rgs9 UTSW 11 109239594 critical splice acceptor site probably null
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6046:Rgs9 UTSW 11 109239560 missense probably damaging 1.00
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R7325:Rgs9 UTSW 11 109276581 missense probably damaging 1.00
R7453:Rgs9 UTSW 11 109227268 missense probably damaging 1.00
R7864:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R8035:Rgs9 UTSW 11 109273324 missense probably benign 0.28
R8885:Rgs9 UTSW 11 109275623 missense probably damaging 1.00
R8960:Rgs9 UTSW 11 109248989 missense possibly damaging 0.46
R9157:Rgs9 UTSW 11 109225723 missense probably damaging 0.96
Z1177:Rgs9 UTSW 11 109239592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGCACTTGGGCACTTGGG -3'
(R):5'- CAATGTCTGTGGCATGCTGG -3'

Sequencing Primer
(F):5'- ACGTCTGATGGCGTCTGC -3'
(R):5'- CTGTGGCATGCTGGTCCTTG -3'
Posted On 2014-11-12