Incidental Mutation 'R2422:Mettl22'
ID 249405
Institutional Source Beutler Lab
Gene Symbol Mettl22
Ensembl Gene ENSMUSG00000039345
Gene Name methyltransferase 22, Kin17 lysine
Synonyms
MMRRC Submission 040384-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2422 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 8288623-8308069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8305225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 293 (F293L)
Ref Sequence ENSEMBL: ENSMUSP00000044108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046470] [ENSMUST00000142899] [ENSMUST00000150790]
AlphaFold Q8R1C6
Predicted Effect probably damaging
Transcript: ENSMUST00000046470
AA Change: F293L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044108
Gene: ENSMUSG00000039345
AA Change: F293L

DomainStartEndE-ValueType
Pfam:Methyltransf_16 154 337 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133208
Predicted Effect probably benign
Transcript: ENSMUST00000142899
SMART Domains Protein: ENSMUSP00000120894
Gene: ENSMUSG00000039345

DomainStartEndE-ValueType
Pfam:Methyltransf_16 116 209 9.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150790
AA Change: F79L

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114563
Gene: ENSMUSG00000039345
AA Change: F79L

DomainStartEndE-ValueType
Pfam:Methyltransf_16 1 118 2.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151233
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-histone lysine methyltransferases. It interacts with its substrate, Kin17, which is involved in DNA repair and replication and mRNA processing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,421,864 (GRCm39) N47I probably benign Het
Actr5 T C 2: 158,478,001 (GRCm39) F457S probably damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Adck2 C T 6: 39,560,932 (GRCm39) A440V possibly damaging Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc121rt3 A T 5: 112,502,984 (GRCm39) V240D probably damaging Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Ccdc77 A G 6: 120,316,120 (GRCm39) C186R probably benign Het
Cdk12 T G 11: 98,109,900 (GRCm39) S640R probably benign Het
Cdv3 T C 9: 103,242,317 (GRCm39) probably benign Het
Celf2 G A 2: 6,558,700 (GRCm39) T364I probably damaging Het
Cmtr2 C A 8: 110,949,413 (GRCm39) S574R probably benign Het
Col14a1 T C 15: 55,313,318 (GRCm39) L56P unknown Het
Cracdl C A 1: 37,652,556 (GRCm39) V1084L probably benign Het
Dctn1 C T 6: 83,176,782 (GRCm39) L1241F possibly damaging Het
Depdc5 T C 5: 33,148,379 (GRCm39) F1505S probably damaging Het
Dhcr24 G T 4: 106,418,291 (GRCm39) probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Entpd7 A T 19: 43,716,527 (GRCm39) Y507F possibly damaging Het
Fbp1 T C 13: 63,019,120 (GRCm39) K24E probably benign Het
Galr1 A T 18: 82,424,048 (GRCm39) N76K probably damaging Het
Glrb A G 3: 80,767,542 (GRCm39) I226T probably damaging Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm4950 T A 18: 51,998,856 (GRCm39) Q33L probably benign Het
Gnat2 A T 3: 108,002,855 (GRCm39) M88L probably damaging Het
Gpr183 A G 14: 122,191,589 (GRCm39) Y311H probably damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Hipk3 C T 2: 104,301,830 (GRCm39) G121R probably benign Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Homez C A 14: 55,095,031 (GRCm39) V226F probably benign Het
Inf2 C A 12: 112,577,258 (GRCm39) A1034D unknown Het
Kcnc4 G T 3: 107,352,863 (GRCm39) P572T probably benign Het
Kmt2d T C 15: 98,760,147 (GRCm39) E1037G unknown Het
Krt78 T C 15: 101,855,699 (GRCm39) E704G probably damaging Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lmbrd2 C T 15: 9,194,852 (GRCm39) T618M possibly damaging Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Mib1 T C 18: 10,751,906 (GRCm39) S263P probably damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Nek1 T C 8: 61,472,935 (GRCm39) V152A probably damaging Het
Nlrp4d T A 7: 10,096,872 (GRCm39) D876V probably benign Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or11g7 T C 14: 50,690,893 (GRCm39) L128P probably damaging Het
Or5an11 A T 19: 12,246,283 (GRCm39) T230S probably damaging Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Pcdha11 G T 18: 37,140,325 (GRCm39) L651F probably damaging Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Plxnb1 G A 9: 108,937,506 (GRCm39) R1169H probably benign Het
Ppp4r3a A G 12: 101,008,912 (GRCm39) probably benign Het
Pum2 A T 12: 8,798,931 (GRCm39) Q930L possibly damaging Het
Rbp4 T C 19: 38,112,792 (GRCm39) E67G probably damaging Het
Rgs9 C A 11: 109,116,603 (GRCm39) probably null Het
Semp2l1 C T 1: 32,584,942 (GRCm39) A323T possibly damaging Het
Sipa1 A T 19: 5,702,140 (GRCm39) D923E possibly damaging Het
Smc1a A G X: 150,830,971 (GRCm39) probably benign Het
Snx33 C A 9: 56,825,822 (GRCm39) M546I probably benign Het
Spag17 T A 3: 99,934,935 (GRCm39) W714R probably benign Het
Spata2 C T 2: 167,326,126 (GRCm39) R231Q probably damaging Het
Stard9 C T 2: 120,530,765 (GRCm39) R2341C probably benign Het
Tas2r116 A T 6: 132,832,557 (GRCm39) I53F possibly damaging Het
Tlk1 T C 2: 70,600,349 (GRCm39) E110G probably damaging Het
Tmem102 T A 11: 69,695,363 (GRCm39) E203V probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Tyw5 A G 1: 57,435,907 (GRCm39) I82T possibly damaging Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Wdr77 A T 3: 105,867,337 (GRCm39) K62* probably null Het
Zfhx4 C A 3: 5,455,465 (GRCm39) A1153E probably benign Het
Zfp266 C A 9: 20,410,558 (GRCm39) V540L possibly damaging Het
Zfp638 C A 6: 83,943,421 (GRCm39) probably benign Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Zfp951 G A 5: 104,963,143 (GRCm39) T141I probably benign Het
Other mutations in Mettl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Mettl22 APN 16 8,302,117 (GRCm39) splice site probably benign
IGL02178:Mettl22 APN 16 8,296,146 (GRCm39) missense probably benign 0.01
IGL02632:Mettl22 APN 16 8,302,117 (GRCm39) splice site probably benign
R0535:Mettl22 UTSW 16 8,302,210 (GRCm39) splice site probably benign
R0840:Mettl22 UTSW 16 8,300,021 (GRCm39) missense probably damaging 0.99
R1473:Mettl22 UTSW 16 8,291,825 (GRCm39) missense probably damaging 1.00
R5166:Mettl22 UTSW 16 8,296,115 (GRCm39) missense probably benign 0.03
R5236:Mettl22 UTSW 16 8,306,597 (GRCm39) nonsense probably null
R6488:Mettl22 UTSW 16 8,305,225 (GRCm39) missense probably damaging 0.99
R6492:Mettl22 UTSW 16 8,306,755 (GRCm39) splice site probably null
R7179:Mettl22 UTSW 16 8,295,924 (GRCm39) missense probably benign 0.00
R7770:Mettl22 UTSW 16 8,303,764 (GRCm39) missense possibly damaging 0.93
R8159:Mettl22 UTSW 16 8,306,633 (GRCm39) missense probably benign 0.24
R8275:Mettl22 UTSW 16 8,303,792 (GRCm39) missense possibly damaging 0.94
R8810:Mettl22 UTSW 16 8,303,792 (GRCm39) missense probably damaging 1.00
R8815:Mettl22 UTSW 16 8,300,178 (GRCm39) missense probably benign 0.00
R9109:Mettl22 UTSW 16 8,305,231 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGACAAGCCTCACTTCACTC -3'
(R):5'- GCCCAGCACACAGTAGATATATG -3'

Sequencing Primer
(F):5'- TTCACTCTTAGACACATCCCGGAAG -3'
(R):5'- GTGTATGACACCAGCACACAGTAG -3'
Posted On 2014-11-12