Incidental Mutation 'R2422:Entpd7'
ID 249418
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Name ectonucleoside triphosphate diphosphohydrolase 7
Synonyms 1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
MMRRC Submission 040384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R2422 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 43689672-43733697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43728088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 507 (Y507F)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
AlphaFold Q3TCT4
Predicted Effect possibly damaging
Transcript: ENSMUST00000081079
AA Change: Y507F

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: Y507F

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131293
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,613,475 V1084L probably benign Het
4933409G03Rik A T 2: 68,591,520 N47I probably benign Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Adck2 C T 6: 39,583,998 A440V possibly damaging Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Ccdc77 A G 6: 120,339,159 C186R probably benign Het
Cdk12 T G 11: 98,219,074 S640R probably benign Het
Cdv3 T C 9: 103,365,118 probably benign Het
Celf2 G A 2: 6,553,889 T364I probably damaging Het
Cmtr2 C A 8: 110,222,781 S574R probably benign Het
Col14a1 T C 15: 55,449,922 L56P unknown Het
Dctn1 C T 6: 83,199,800 L1241F possibly damaging Het
Depdc5 T C 5: 32,991,035 F1505S probably damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Galr1 A T 18: 82,405,923 N76K probably damaging Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm4950 T A 18: 51,865,784 Q33L probably benign Het
Gm5415 C T 1: 32,545,861 A323T possibly damaging Het
Gm6583 A T 5: 112,355,118 V240D probably damaging Het
Gnat2 A T 3: 108,095,539 M88L probably damaging Het
Gpr183 A G 14: 121,954,177 Y311H probably damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hipk3 C T 2: 104,471,485 G121R probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Homez C A 14: 54,857,574 V226F probably benign Het
Inf2 C A 12: 112,610,824 A1034D unknown Het
Kcnc4 G T 3: 107,445,547 P572T probably benign Het
Kmt2d T C 15: 98,862,266 E1037G unknown Het
Krt78 T C 15: 101,947,264 E704G probably damaging Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lmbrd2 C T 15: 9,194,765 T618M possibly damaging Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mettl22 T C 16: 8,487,361 F293L probably damaging Het
Mib1 T C 18: 10,751,906 S263P probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Nek1 T C 8: 61,019,901 V152A probably damaging Het
Nlrp4d T A 7: 10,362,945 D876V probably benign Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr235 A T 19: 12,268,919 T230S probably damaging Het
Olfr740 T C 14: 50,453,436 L128P probably damaging Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pcdha11 G T 18: 37,007,272 L651F probably damaging Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Plxnb1 G A 9: 109,108,438 R1169H probably benign Het
Ppp4r3a A G 12: 101,042,653 probably benign Het
Pum2 A T 12: 8,748,931 Q930L possibly damaging Het
Rbp4 T C 19: 38,124,344 E67G probably damaging Het
Rgs9 C A 11: 109,225,777 probably null Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Smc1a A G X: 152,047,975 probably benign Het
Snx33 C A 9: 56,918,538 M546I probably benign Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Spata2 C T 2: 167,484,206 R231Q probably damaging Het
Stard9 C T 2: 120,700,284 R2341C probably benign Het
Tas2r116 A T 6: 132,855,594 I53F possibly damaging Het
Tlk1 T C 2: 70,770,005 E110G probably damaging Het
Tmem102 T A 11: 69,804,537 E203V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyw5 A G 1: 57,396,748 I82T possibly damaging Het
Uba6 A G 5: 86,132,616 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wdr77 A T 3: 105,960,021 K62* probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp266 C A 9: 20,499,262 V540L possibly damaging Het
Zfp638 C A 6: 83,966,439 probably benign Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Zfp951 G A 5: 104,815,277 T141I probably benign Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1532:Entpd7 UTSW 19 43691077 missense possibly damaging 0.76
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R3949:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4095:Entpd7 UTSW 19 43704201 missense probably damaging 1.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
R8880:Entpd7 UTSW 19 43704407 splice site probably benign
R9318:Entpd7 UTSW 19 43704270 missense possibly damaging 0.88
R9564:Entpd7 UTSW 19 43717450 missense probably benign 0.01
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATGCATTGCGGTTCC -3'
(R):5'- TCCAGACAGATCCATCTCGTC -3'

Sequencing Primer
(F):5'- GAATGCATTGCGGTTCCCTTTTTC -3'
(R):5'- AGGCACAATAGGTTTATTCTCTGGC -3'
Posted On 2014-11-12