Mutagenetix > Incidental Mutation

Incidental Mutation 'R2422:Smc1a'

249419

Institutional Source

Beutler Lab

Gene Symbol

Smc1a

Ensembl Gene

ENSMUSG00000041133

Gene Name

structural maintenance of chromosomes 1A

Synonyms

Smc1alpha, SB1.8, 5830426I24Rik, Smc1l1, Smc1, SMCB

MMRRC Submission

040384-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R2422 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

152016428-152062694 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 152047975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045312]

AlphaFold

Q9CU62

PDB Structure

SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000045312

SMART Domains

Protein: ENSMUSP00000044645
Gene: ENSMUSG00000041133

Domain	Start	End	E-Value	Type
Pfam:AAA_29	4	57	6.7e-10	PFAM
Pfam:AAA_23	7	299	8.3e-15	PFAM
low complexity region	347	361	N/A	INTRINSIC
SMC_hinge	513	629	5.39e-34	SMART
low complexity region	673	687	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	1045	1061	N/A	INTRINSIC
PDB:1W1W\|D	1062	1223	2e-40	PDB
Blast:AAA	1070	1222	3e-25	BLAST
SCOP:d1e69a_	1119	1208	5e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131395

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased chromosomal instability, decreased cell survival, and defective S-phase checkpoint after ionizing radiation exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	C	A	1: 37,613,475	V1084L	probably benign	Het
4933409G03Rik	A	T	2: 68,591,520	N47I	probably benign	Het
Actr5	T	C	2: 158,636,081	F457S	probably damaging	Het
Adamts3	A	G	5: 89,683,175	S1007P	probably damaging	Het
Adck2	C	T	6: 39,583,998	A440V	possibly damaging	Het
Birc6	T	A	17: 74,660,614	L301Q	probably damaging	Het
Ccdc18	A	C	5: 108,228,588	E1298D	probably damaging	Het
Ccdc77	A	G	6: 120,339,159	C186R	probably benign	Het
Cdk12	T	G	11: 98,219,074	S640R	probably benign	Het
Cdv3	T	C	9: 103,365,118		probably benign	Het
Celf2	G	A	2: 6,553,889	T364I	probably damaging	Het
Cmtr2	C	A	8: 110,222,781	S574R	probably benign	Het
Col14a1	T	C	15: 55,449,922	L56P	unknown	Het
Dctn1	C	T	6: 83,199,800	L1241F	possibly damaging	Het
Depdc5	T	C	5: 32,991,035	F1505S	probably damaging	Het
Dhcr24	G	T	4: 106,561,094		probably benign	Het
Dnajc21	A	G	15: 10,461,935	S127P	probably benign	Het
Entpd7	A	T	19: 43,728,088	Y507F	possibly damaging	Het
Fbp1	T	C	13: 62,871,306	K24E	probably benign	Het
Galr1	A	T	18: 82,405,923	N76K	probably damaging	Het
Glrb	A	G	3: 80,860,235	I226T	probably damaging	Het
Gm17421	T	A	12: 113,369,487		noncoding transcript	Het
Gm4950	T	A	18: 51,865,784	Q33L	probably benign	Het
Gm5415	C	T	1: 32,545,861	A323T	possibly damaging	Het
Gm6583	A	T	5: 112,355,118	V240D	probably damaging	Het
Gnat2	A	T	3: 108,095,539	M88L	probably damaging	Het
Gpr183	A	G	14: 121,954,177	Y311H	probably damaging	Het
H2-M10.5	A	G	17: 36,774,999	I308V	probably benign	Het
Hipk3	C	T	2: 104,471,485	G121R	probably benign	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homez	C	A	14: 54,857,574	V226F	probably benign	Het
Inf2	C	A	12: 112,610,824	A1034D	unknown	Het
Kcnc4	G	T	3: 107,445,547	P572T	probably benign	Het
Kmt2d	T	C	15: 98,862,266	E1037G	unknown	Het
Krt78	T	C	15: 101,947,264	E704G	probably damaging	Het
Lama1	A	T	17: 67,750,553	M541L	probably benign	Het
Lmbrd2	C	T	15: 9,194,765	T618M	possibly damaging	Het
Ly6g6e	G	A	17: 35,078,146	R121Q	probably benign	Het
Mettl22	T	C	16: 8,487,361	F293L	probably damaging	Het
Mib1	T	C	18: 10,751,906	S263P	probably damaging	Het
Ndufaf1	T	C	2: 119,655,737	E298G	probably damaging	Het
Nek1	T	C	8: 61,019,901	V152A	probably damaging	Het
Nlrp4d	T	A	7: 10,362,945	D876V	probably benign	Het
Olfr178	T	C	16: 58,889,965	E85G	probably benign	Het
Olfr235	A	T	19: 12,268,919	T230S	probably damaging	Het
Olfr740	T	C	14: 50,453,436	L128P	probably damaging	Het
Olfr975	A	G	9: 39,950,528	L81P	possibly damaging	Het
Pcdha11	G	T	18: 37,007,272	L651F	probably damaging	Het
Plekhg1	G	A	10: 3,958,048	M988I	probably benign	Het
Plxnb1	G	A	9: 109,108,438	R1169H	probably benign	Het
Ppp4r3a	A	G	12: 101,042,653		probably benign	Het
Pum2	A	T	12: 8,748,931	Q930L	possibly damaging	Het
Rbp4	T	C	19: 38,124,344	E67G	probably damaging	Het
Rgs9	C	A	11: 109,225,777		probably null	Het
Sipa1	A	T	19: 5,652,112	D923E	possibly damaging	Het
Snx33	C	A	9: 56,918,538	M546I	probably benign	Het
Spag17	T	A	3: 100,027,619	W714R	probably benign	Het
Spata2	C	T	2: 167,484,206	R231Q	probably damaging	Het
Stard9	C	T	2: 120,700,284	R2341C	probably benign	Het
Tas2r116	A	T	6: 132,855,594	I53F	possibly damaging	Het
Tlk1	T	C	2: 70,770,005	E110G	probably damaging	Het
Tmem102	T	A	11: 69,804,537	E203V	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Tyw5	A	G	1: 57,396,748	I82T	possibly damaging	Het
Uba6	A	G	5: 86,132,616		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc13c	T	C	9: 73,931,547	Y674C	probably damaging	Het
Vmn2r105	T	A	17: 20,227,835	R242S	probably benign	Het
Vmn2r12	A	G	5: 109,086,532	Y605H	probably benign	Het
Wdr77	A	T	3: 105,960,021	K62*	probably null	Het
Zfhx4	C	A	3: 5,390,405	A1153E	probably benign	Het
Zfp266	C	A	9: 20,499,262	V540L	possibly damaging	Het
Zfp638	C	A	6: 83,966,439		probably benign	Het
Zfp644	A	G	5: 106,637,244	M479T	possibly damaging	Het
Zfp951	G	A	5: 104,815,277	T141I	probably benign	Het

Other mutations in Smc1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Smc1a	APN	X	152036129	missense	probably damaging	1.00
IGL02385:Smc1a	APN	X	152037659	missense	possibly damaging	0.67
R2421:Smc1a	UTSW	X	152047975	splice site	probably benign
R2939:Smc1a	UTSW	X	152033699	missense	probably damaging	1.00
R2940:Smc1a	UTSW	X	152033699	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCATCTAGCAAAGGAGTTC -3'
(R):5'- ACCTGTGGGACCAATTGTAGAG -3'

Sequencing Primer
(F):5'- GGAGTTCCTAATCTCTAGAGGGATAC -3'
(R):5'- CCTGTGGGACCAATTGTAGAGATAGC -3'

Posted On

2014-11-12