Incidental Mutation 'R2423:Rbbp8nl'
ID 249427
Institutional Source Beutler Lab
Gene Symbol Rbbp8nl
Ensembl Gene ENSMUSG00000038980
Gene Name RBBP8 N-terminal like
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 180277646-180289879 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 180280971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 210 (S210T)
Ref Sequence ENSEMBL: ENSMUSP00000047237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038529]
AlphaFold A2ABX0
Predicted Effect probably damaging
Transcript: ENSMUST00000038529
AA Change: S210T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047237
Gene: ENSMUSG00000038980
AA Change: S210T

DomainStartEndE-ValueType
Pfam:CtIP_N 4 123 5.6e-56 PFAM
low complexity region 143 154 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
low complexity region 237 250 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
low complexity region 352 361 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 585 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Rbbp8nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rbbp8nl APN 2 180279695 missense probably benign 0.01
IGL01845:Rbbp8nl APN 2 180283311 missense probably damaging 0.99
IGL01966:Rbbp8nl APN 2 180280989 splice site probably benign
IGL02217:Rbbp8nl APN 2 180278188 unclassified probably benign
IGL02500:Rbbp8nl APN 2 180279329 missense possibly damaging 0.57
IGL02623:Rbbp8nl APN 2 180281443 missense probably damaging 0.99
IGL02634:Rbbp8nl APN 2 180280895 missense probably benign 0.00
F5770:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
R0380:Rbbp8nl UTSW 2 180281719 missense probably damaging 0.96
R1773:Rbbp8nl UTSW 2 180281194 missense probably benign 0.00
R1858:Rbbp8nl UTSW 2 180282213 splice site probably benign
R1901:Rbbp8nl UTSW 2 180283313 missense probably damaging 1.00
R1962:Rbbp8nl UTSW 2 180280874 missense probably benign 0.03
R2495:Rbbp8nl UTSW 2 180279102 missense probably null 0.31
R3738:Rbbp8nl UTSW 2 180281248 missense probably benign 0.37
R4460:Rbbp8nl UTSW 2 180280971 missense probably benign 0.41
R4502:Rbbp8nl UTSW 2 180279196 missense possibly damaging 0.48
R5573:Rbbp8nl UTSW 2 180279793 missense possibly damaging 0.95
R5699:Rbbp8nl UTSW 2 180278668 missense probably damaging 0.98
R6242:Rbbp8nl UTSW 2 180280974 missense probably damaging 1.00
R6269:Rbbp8nl UTSW 2 180281512 nonsense probably null
R6586:Rbbp8nl UTSW 2 180280959 missense probably damaging 1.00
R6875:Rbbp8nl UTSW 2 180279226 missense probably benign 0.00
R8055:Rbbp8nl UTSW 2 180278208 missense probably benign 0.00
R8344:Rbbp8nl UTSW 2 180279713 missense probably benign 0.18
R8944:Rbbp8nl UTSW 2 180277976 nonsense probably null
R9279:Rbbp8nl UTSW 2 180279101 critical splice donor site probably null
R9352:Rbbp8nl UTSW 2 180279260 missense probably benign 0.00
V7581:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
V7582:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGAGTTGTTCCCAGTGGTG -3'
(R):5'- ATGGTAAGGATGTAACTCCTGACC -3'

Sequencing Primer
(F):5'- CAGTGGTGGGGGTGACAC -3'
(R):5'- ACACTGCGTGCCTTCCAG -3'
Posted On 2014-11-12