Incidental Mutation 'R2423:Nbea'
ID 249428
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 55532616-56091122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55992727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 293 (T293I)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029374
AA Change: T293I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: T293I

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,616,656 (GRCm39) S284P possibly damaging Het
Ap5z1 T C 5: 142,462,532 (GRCm39) V614A probably benign Het
Arhgap9 A T 10: 127,162,993 (GRCm39) probably null Het
Brf1 G A 12: 112,963,819 (GRCm39) A53V probably benign Het
Cyp1a2 C T 9: 57,587,232 (GRCm39) R353Q probably damaging Het
Deup1 G T 9: 15,503,754 (GRCm39) S269* probably null Het
F11r T A 1: 171,289,191 (GRCm39) Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Mapkbp1 A T 2: 119,855,071 (GRCm39) E1430V probably benign Het
Mga A G 2: 119,795,274 (GRCm39) K2986R probably damaging Het
Myo9b G T 8: 71,780,584 (GRCm39) V494L probably damaging Het
Neto2 C T 8: 86,396,396 (GRCm39) R83Q probably damaging Het
Ocm A T 5: 143,961,388 (GRCm39) probably null Het
Or52z14 C T 7: 103,253,241 (GRCm39) R127C probably benign Het
Pcdha11 T C 18: 37,140,477 (GRCm39) I702T possibly damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Rbbp8nl A T 2: 179,922,764 (GRCm39) S210T probably damaging Het
Rbl2 A T 8: 91,813,774 (GRCm39) I340F probably benign Het
Rft1 T C 14: 30,388,724 (GRCm39) L216P possibly damaging Het
Slc26a10 T A 10: 127,015,606 (GRCm39) probably null Het
Slc34a1 G A 13: 55,556,865 (GRCm39) A235T possibly damaging Het
Spag17 A G 3: 100,010,772 (GRCm39) T2089A probably benign Het
Srek1 G C 13: 103,889,536 (GRCm39) S260* probably null Het
Sspo T C 6: 48,430,989 (GRCm39) V624A probably benign Het
Tapt1 T C 5: 44,349,795 (GRCm39) I251V probably benign Het
Tmem248 T C 5: 130,258,403 (GRCm39) I32T probably damaging Het
Tnk1 T G 11: 69,746,587 (GRCm39) T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,792,511 (GRCm39) probably null Het
Trp53tg5 T A 2: 164,313,250 (GRCm39) R142* probably null Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Vldlr C T 19: 27,213,688 (GRCm39) T125I possibly damaging Het
Vps8 A G 16: 21,378,087 (GRCm39) T1033A probably benign Het
Wiz A C 17: 32,580,859 (GRCm39) H197Q probably damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,535,914 (GRCm39) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,875,510 (GRCm39) missense probably benign 0.02
IGL00584:Nbea APN 3 55,989,869 (GRCm39) missense probably damaging 0.98
IGL00648:Nbea APN 3 55,916,681 (GRCm39) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,862,814 (GRCm39) missense probably benign
IGL00899:Nbea APN 3 55,550,266 (GRCm39) missense probably benign 0.32
IGL00955:Nbea APN 3 55,912,893 (GRCm39) missense possibly damaging 0.45
IGL01296:Nbea APN 3 55,938,957 (GRCm39) missense probably benign 0.04
IGL01299:Nbea APN 3 55,598,315 (GRCm39) missense probably damaging 1.00
IGL01393:Nbea APN 3 55,912,729 (GRCm39) missense probably benign 0.02
IGL01550:Nbea APN 3 55,712,669 (GRCm39) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,588,437 (GRCm39) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,875,577 (GRCm39) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,625,308 (GRCm39) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,875,588 (GRCm39) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,899,913 (GRCm39) missense probably benign
IGL02188:Nbea APN 3 55,891,258 (GRCm39) missense probably benign 0.00
IGL02319:Nbea APN 3 55,893,159 (GRCm39) missense probably damaging 1.00
IGL02406:Nbea APN 3 55,993,687 (GRCm39) missense probably benign 0.02
IGL02494:Nbea APN 3 55,712,772 (GRCm39) missense probably benign 0.02
IGL02550:Nbea APN 3 55,926,835 (GRCm39) missense probably damaging 0.98
IGL02706:Nbea APN 3 55,944,699 (GRCm39) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,539,483 (GRCm39) nonsense probably null
IGL02822:Nbea APN 3 55,926,868 (GRCm39) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,539,407 (GRCm39) missense probably benign 0.01
IGL03000:Nbea APN 3 55,912,048 (GRCm39) missense possibly damaging 0.94
IGL03081:Nbea APN 3 55,987,339 (GRCm39) missense probably damaging 1.00
IGL03091:Nbea APN 3 55,992,725 (GRCm39) missense probably damaging 1.00
IGL03368:Nbea APN 3 55,987,351 (GRCm39) missense probably damaging 0.98
Neches UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
scotland UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
Wales UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
FR4340:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
G4846:Nbea UTSW 3 55,994,918 (GRCm39) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,625,290 (GRCm39) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,608,948 (GRCm39) intron probably benign
R0087:Nbea UTSW 3 55,998,444 (GRCm39) missense possibly damaging 0.92
R0220:Nbea UTSW 3 55,912,724 (GRCm39) missense probably benign 0.30
R0324:Nbea UTSW 3 55,965,369 (GRCm39) critical splice donor site probably null
R0330:Nbea UTSW 3 55,550,238 (GRCm39) missense probably benign 0.27
R0391:Nbea UTSW 3 55,944,698 (GRCm39) missense probably damaging 1.00
R0394:Nbea UTSW 3 55,937,328 (GRCm39) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,726,715 (GRCm39) missense probably benign 0.05
R0503:Nbea UTSW 3 55,550,257 (GRCm39) missense possibly damaging 0.79
R0521:Nbea UTSW 3 55,915,689 (GRCm39) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,535,917 (GRCm39) missense probably benign 0.18
R0894:Nbea UTSW 3 55,916,761 (GRCm39) missense possibly damaging 0.89
R1072:Nbea UTSW 3 55,993,617 (GRCm39) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,764,427 (GRCm39) nonsense probably null
R1169:Nbea UTSW 3 55,875,744 (GRCm39) missense probably benign 0.00
R1241:Nbea UTSW 3 55,965,461 (GRCm39) missense probably damaging 1.00
R1269:Nbea UTSW 3 55,912,202 (GRCm39) missense probably benign 0.05
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1457:Nbea UTSW 3 55,992,748 (GRCm39) missense probably damaging 1.00
R1482:Nbea UTSW 3 55,987,414 (GRCm39) missense probably damaging 1.00
R1483:Nbea UTSW 3 55,910,211 (GRCm39) missense probably benign 0.25
R1502:Nbea UTSW 3 55,912,310 (GRCm39) missense probably benign 0.03
R1544:Nbea UTSW 3 55,966,248 (GRCm39) missense probably damaging 0.99
R1629:Nbea UTSW 3 55,910,312 (GRCm39) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,537,650 (GRCm39) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,553,407 (GRCm39) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,573,116 (GRCm39) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,537,610 (GRCm39) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,841,940 (GRCm39) missense probably benign 0.00
R1796:Nbea UTSW 3 55,551,129 (GRCm39) missense possibly damaging 0.48
R1844:Nbea UTSW 3 55,989,857 (GRCm39) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,550,310 (GRCm39) missense probably benign 0.12
R1938:Nbea UTSW 3 55,992,743 (GRCm39) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,860,521 (GRCm39) missense possibly damaging 0.78
R2062:Nbea UTSW 3 55,993,578 (GRCm39) splice site probably benign
R2066:Nbea UTSW 3 55,875,567 (GRCm39) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,630,638 (GRCm39) missense probably damaging 0.96
R2181:Nbea UTSW 3 55,937,360 (GRCm39) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,895,506 (GRCm39) splice site probably null
R2345:Nbea UTSW 3 55,992,700 (GRCm39) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,554,881 (GRCm39) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2881:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2940:Nbea UTSW 3 55,842,045 (GRCm39) missense probably benign 0.24
R3500:Nbea UTSW 3 55,588,431 (GRCm39) missense possibly damaging 0.88
R3765:Nbea UTSW 3 55,912,970 (GRCm39) missense probably damaging 1.00
R3790:Nbea UTSW 3 55,912,450 (GRCm39) missense probably benign
R3808:Nbea UTSW 3 55,625,269 (GRCm39) missense probably benign 0.02
R3845:Nbea UTSW 3 55,993,713 (GRCm39) splice site probably benign
R4182:Nbea UTSW 3 55,915,848 (GRCm39) missense probably damaging 0.99
R4385:Nbea UTSW 3 55,908,059 (GRCm39) missense possibly damaging 0.77
R4419:Nbea UTSW 3 55,917,021 (GRCm39) missense probably damaging 1.00
R4426:Nbea UTSW 3 55,989,800 (GRCm39) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,899,753 (GRCm39) critical splice donor site probably null
R4456:Nbea UTSW 3 55,551,205 (GRCm39) missense probably benign 0.00
R4604:Nbea UTSW 3 55,631,069 (GRCm39) missense probably benign 0.18
R4687:Nbea UTSW 3 55,965,486 (GRCm39) missense probably damaging 1.00
R4758:Nbea UTSW 3 55,912,824 (GRCm39) missense probably benign
R4840:Nbea UTSW 3 55,618,091 (GRCm39) missense probably benign 0.37
R4888:Nbea UTSW 3 55,912,776 (GRCm39) missense possibly damaging 0.61
R4954:Nbea UTSW 3 55,943,379 (GRCm39) missense probably damaging 1.00
R4972:Nbea UTSW 3 55,992,667 (GRCm39) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,860,466 (GRCm39) missense probably benign 0.00
R4980:Nbea UTSW 3 55,554,772 (GRCm39) splice site probably null
R5104:Nbea UTSW 3 55,987,348 (GRCm39) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,534,384 (GRCm39) missense possibly damaging 0.90
R5166:Nbea UTSW 3 55,926,874 (GRCm39) missense probably damaging 1.00
R5347:Nbea UTSW 3 55,948,297 (GRCm39) missense probably damaging 1.00
R5350:Nbea UTSW 3 55,926,845 (GRCm39) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,553,410 (GRCm39) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,539,392 (GRCm39) missense probably benign 0.08
R5627:Nbea UTSW 3 55,899,766 (GRCm39) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,536,007 (GRCm39) missense possibly damaging 0.53
R5765:Nbea UTSW 3 55,912,719 (GRCm39) missense probably benign 0.15
R5853:Nbea UTSW 3 55,899,822 (GRCm39) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
R5955:Nbea UTSW 3 55,588,404 (GRCm39) missense probably benign 0.00
R5976:Nbea UTSW 3 55,761,268 (GRCm39) missense probably benign 0.30
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6043:Nbea UTSW 3 55,693,896 (GRCm39) missense probably benign 0.32
R6122:Nbea UTSW 3 55,937,317 (GRCm39) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,535,905 (GRCm39) missense probably damaging 0.97
R6331:Nbea UTSW 3 55,908,037 (GRCm39) missense possibly damaging 0.94
R6334:Nbea UTSW 3 55,944,570 (GRCm39) missense probably damaging 1.00
R6393:Nbea UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,712,778 (GRCm39) missense probably benign 0.01
R6457:Nbea UTSW 3 55,907,990 (GRCm39) missense probably damaging 1.00
R6476:Nbea UTSW 3 55,912,227 (GRCm39) missense probably benign 0.00
R6488:Nbea UTSW 3 55,625,264 (GRCm39) missense probably damaging 0.99
R6700:Nbea UTSW 3 55,989,869 (GRCm39) missense possibly damaging 0.89
R6702:Nbea UTSW 3 55,912,923 (GRCm39) missense probably benign 0.06
R6752:Nbea UTSW 3 55,944,640 (GRCm39) missense probably benign
R6752:Nbea UTSW 3 55,875,730 (GRCm39) missense probably benign 0.02
R6804:Nbea UTSW 3 55,994,874 (GRCm39) missense probably benign 0.37
R6901:Nbea UTSW 3 55,926,836 (GRCm39) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,631,031 (GRCm39) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,899,865 (GRCm39) missense probably damaging 1.00
R7211:Nbea UTSW 3 55,912,322 (GRCm39) missense probably benign 0.05
R7308:Nbea UTSW 3 55,998,452 (GRCm39) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,712,687 (GRCm39) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,625,200 (GRCm39) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,557,126 (GRCm39) missense probably damaging 1.00
R7833:Nbea UTSW 3 55,910,218 (GRCm39) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,573,110 (GRCm39) missense probably damaging 0.97
R7935:Nbea UTSW 3 55,966,086 (GRCm39) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,895,402 (GRCm39) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,726,736 (GRCm39) missense probably benign 0.11
R8290:Nbea UTSW 3 55,966,056 (GRCm39) nonsense probably null
R8314:Nbea UTSW 3 55,916,672 (GRCm39) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,090,518 (GRCm39) missense possibly damaging 0.86
R8376:Nbea UTSW 3 55,551,076 (GRCm39) missense possibly damaging 0.79
R8410:Nbea UTSW 3 55,944,684 (GRCm39) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,554,807 (GRCm39) missense probably benign 0.25
R8753:Nbea UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
R8844:Nbea UTSW 3 55,998,415 (GRCm39) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,712,720 (GRCm39) missense probably benign 0.00
R8886:Nbea UTSW 3 55,966,148 (GRCm39) missense probably damaging 1.00
R8890:Nbea UTSW 3 55,926,784 (GRCm39) splice site probably benign
R9004:Nbea UTSW 3 55,910,359 (GRCm39) missense probably benign 0.01
R9022:Nbea UTSW 3 55,551,110 (GRCm39) missense possibly damaging 0.79
R9080:Nbea UTSW 3 55,912,516 (GRCm39) nonsense probably null
R9087:Nbea UTSW 3 55,550,157 (GRCm39) critical splice donor site probably null
R9104:Nbea UTSW 3 55,862,809 (GRCm39) missense probably benign
R9165:Nbea UTSW 3 55,912,289 (GRCm39) missense probably benign 0.15
R9219:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9221:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9222:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9260:Nbea UTSW 3 55,891,233 (GRCm39) missense possibly damaging 0.50
R9263:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9265:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9294:Nbea UTSW 3 55,998,513 (GRCm39) missense probably benign 0.00
R9360:Nbea UTSW 3 55,943,319 (GRCm39) missense possibly damaging 0.96
R9387:Nbea UTSW 3 55,898,460 (GRCm39) missense probably benign 0.12
R9428:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9435:Nbea UTSW 3 55,943,309 (GRCm39) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,573,011 (GRCm39) missense probably damaging 1.00
R9514:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9516:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9674:Nbea UTSW 3 55,966,183 (GRCm39) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,557,165 (GRCm39) missense probably benign 0.42
R9709:Nbea UTSW 3 55,693,879 (GRCm39) nonsense probably null
RF051:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
X0018:Nbea UTSW 3 55,943,469 (GRCm39) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,630,584 (GRCm39) missense probably benign 0.34
Z1177:Nbea UTSW 3 55,938,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTGTTAAAAGACATCACACAG -3'
(R):5'- TGAAGTGGCGATGGTCCTTC -3'

Sequencing Primer
(F):5'- GTGTTAAAAGACATCACACAGAAGTC -3'
(R):5'- AAGTGGCGATGGTCCTTCATATACAG -3'
Posted On 2014-11-12