Incidental Mutation 'R2423:Tapt1'
ID 249430
Institutional Source Beutler Lab
Gene Symbol Tapt1
Ensembl Gene ENSMUSG00000046985
Gene Name transmembrane anterior posterior transformation 1
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 44175154-44226626 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44192453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 251 (I251V)
Ref Sequence ENSEMBL: ENSMUSP00000062110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055128] [ENSMUST00000199374]
AlphaFold Q4VBD2
Predicted Effect probably benign
Transcript: ENSMUST00000055128
AA Change: I251V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062110
Gene: ENSMUSG00000046985
AA Change: I251V

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
Pfam:DUF747 152 456 8.9e-112 PFAM
low complexity region 473 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199265
Predicted Effect probably benign
Transcript: ENSMUST00000199374
SMART Domains Protein: ENSMUSP00000143625
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein that localizes to the centrosome and/or ciliary basal body. Mutations in this gene disrupt Golgi morphology and trafficking and normal primary cilium formation and these mutations are congenitally manifested by severe undermineralization of the intra-uterine skeleton. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. In mouse, this gene is thought to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for an ENU mutation causing a truncation exhibit vertebral trasnformations and defects in rib attachment and the xiphoid process. Mice homozygous for a transgenic gene disruption exhibit cleft palate and possible anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Tapt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Tapt1 APN 5 44178990 missense probably damaging 1.00
IGL03011:Tapt1 APN 5 44193187 missense possibly damaging 0.58
IGL03018:Tapt1 APN 5 44204324 missense probably damaging 1.00
R0385:Tapt1 UTSW 5 44218101 splice site probably null
R0624:Tapt1 UTSW 5 44177106 missense possibly damaging 0.81
R1491:Tapt1 UTSW 5 44218102 critical splice donor site probably null
R4175:Tapt1 UTSW 5 44177105 missense probably benign 0.02
R5794:Tapt1 UTSW 5 44177134 missense probably benign 0.00
R7344:Tapt1 UTSW 5 44188657 missense probably damaging 1.00
R7355:Tapt1 UTSW 5 44177117 missense probably benign
R7464:Tapt1 UTSW 5 44188688 nonsense probably null
R7491:Tapt1 UTSW 5 44188636 missense probably damaging 1.00
R8085:Tapt1 UTSW 5 44178965 missense probably damaging 1.00
R8710:Tapt1 UTSW 5 44194401 missense probably benign 0.16
X0062:Tapt1 UTSW 5 44194357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTTAGAGCAACAGGTAAC -3'
(R):5'- TGTGCCAACTACCAGAGGTAC -3'

Sequencing Primer
(F):5'- GGTAACTAAGAACCCCTTCCATG -3'
(R):5'- ATATGGTCATTTCCCCCATT -3'
Posted On 2014-11-12