Incidental Mutation 'R2423:Tmem248'
ID 249431
Institutional Source Beutler Lab
Gene Symbol Tmem248
Ensembl Gene ENSMUSG00000053094
Gene Name transmembrane protein 248
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 130217081-130243765 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130229562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 32 (I32T)
Ref Sequence ENSEMBL: ENSMUSP00000106929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065329] [ENSMUST00000111298] [ENSMUST00000200802] [ENSMUST00000202305] [ENSMUST00000202612]
AlphaFold Q3TBN1
Predicted Effect probably damaging
Transcript: ENSMUST00000065329
AA Change: I32T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067501
Gene: ENSMUSG00000053094
AA Change: I32T

DomainStartEndE-ValueType
Pfam:TMEM219 10 258 1.7e-97 PFAM
transmembrane domain 268 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111298
AA Change: I32T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106929
Gene: ENSMUSG00000053094
AA Change: I32T

DomainStartEndE-ValueType
Pfam:TMEM219 10 257 1.8e-86 PFAM
transmembrane domain 268 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200802
AA Change: I32T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144363
Gene: ENSMUSG00000053094
AA Change: I32T

DomainStartEndE-ValueType
Pfam:TMEM219 10 105 1e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202305
AA Change: I32T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144452
Gene: ENSMUSG00000053094
AA Change: I32T

DomainStartEndE-ValueType
Pfam:TMEM219 10 149 3.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202954
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Tmem248
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1509:Tmem248 UTSW 5 130229454 start gained probably benign
R1741:Tmem248 UTSW 5 130236823 missense probably benign 0.04
R1782:Tmem248 UTSW 5 130231928 missense probably damaging 1.00
R2014:Tmem248 UTSW 5 130231812 missense probably damaging 1.00
R2197:Tmem248 UTSW 5 130231756 missense probably benign 0.31
R4657:Tmem248 UTSW 5 130231774 missense probably damaging 1.00
R4748:Tmem248 UTSW 5 130236890 missense probably benign 0.32
R5151:Tmem248 UTSW 5 130240397 missense probably damaging 1.00
R5719:Tmem248 UTSW 5 130229588 missense probably damaging 1.00
R5931:Tmem248 UTSW 5 130229508 missense probably damaging 0.99
R6332:Tmem248 UTSW 5 130229469 start codon destroyed probably null 0.97
R9146:Tmem248 UTSW 5 130232010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TATGAGACTGGACTGAGCGCTG -3'
(R):5'- CTATCTGTGTGCCCTTGAATAAC -3'

Sequencing Primer
(F):5'- AGCGCTGCAGCTTAGTG -3'
(R):5'- CTGTGTGCCCTTGAATAACAGAGC -3'
Posted On 2014-11-12