Incidental Mutation 'R2423:Ap5z1'
ID 249432
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Name adaptor-related protein complex 5, zeta 1 subunit
Synonyms C330006K01Rik
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 142463944-142478710 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142476777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 614 (V614A)
Ref Sequence ENSEMBL: ENSMUSP00000143179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000196055]
AlphaFold Q3U829
Predicted Effect probably benign
Transcript: ENSMUST00000038699
AA Change: V630A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: V630A

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196055
AA Change: V614A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: V614A

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198135
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142472251 missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142468036 missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142470314 missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142477113 critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142474459 missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142476889 splice site probably null
IGL02805:Ap5z1 APN 5 142470283 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0094:Ap5z1 UTSW 5 142476812 missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142470562 unclassified probably benign
R0811:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R0812:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142470114 missense probably damaging 1.00
R1248:Ap5z1 UTSW 5 142474500 missense probably benign 0.02
R1374:Ap5z1 UTSW 5 142470458 missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142472236 missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142472341 missense probably benign 0.30
R3790:Ap5z1 UTSW 5 142470413 missense probably benign
R4859:Ap5z1 UTSW 5 142473993 missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142467676 missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142466510 missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142467687 missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142467781 missense probably benign
R5569:Ap5z1 UTSW 5 142474451 missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142468976 missense probably damaging 1.00
R7287:Ap5z1 UTSW 5 142474047 missense probably damaging 0.99
R7407:Ap5z1 UTSW 5 142466575 missense probably benign 0.06
R7537:Ap5z1 UTSW 5 142477298 missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142466284 missense probably benign 0.34
R7894:Ap5z1 UTSW 5 142470436 nonsense probably null
R7895:Ap5z1 UTSW 5 142470558 critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142470149 critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142473980 missense possibly damaging 0.60
R8823:Ap5z1 UTSW 5 142474436 missense probably benign 0.19
R8867:Ap5z1 UTSW 5 142477256 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAAGGCTCCTTAATGGGTGGC -3'
(R):5'- TGATCTGTTCCGCTGTGCAC -3'

Sequencing Primer
(F):5'- CCTTAATGGGTGGCAAGTTTTCCC -3'
(R):5'- GTGCACCTCTTGTCCCAAG -3'
Posted On 2014-11-12