Incidental Mutation 'R2423:Ocm'
ID249433
Institutional Source Beutler Lab
Gene Symbol Ocm
Ensembl Gene ENSMUSG00000029618
Gene Nameoncomodulin
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2423 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144019804-144026670 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 144024570 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031622] [ENSMUST00000085704] [ENSMUST00000110702]
Predicted Effect probably null
Transcript: ENSMUST00000031622
SMART Domains Protein: ENSMUSP00000031622
Gene: ENSMUSG00000029618

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
EFh 43 71 2.41e-4 SMART
EFh 82 109 1.09e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085704
SMART Domains Protein: ENSMUSP00000082848
Gene: ENSMUSG00000029618

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
EFh 43 71 2.41e-4 SMART
EFh 82 109 1.09e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110702
SMART Domains Protein: ENSMUSP00000106330
Gene: ENSMUSG00000029618

DomainStartEndE-ValueType
SCOP:d2pvba_ 7 60 5e-7 SMART
PDB:2NLN|A 17 60 6e-25 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Oncomodulin is a high-affinity calcium ion-binding protein. It belongs to the superfamily of calmodulin proteins, also known as the EF-hand proteins. Oncomodulin is an oncodevelopmental protein found in early embryonic cells in the placenta and also in tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibti deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Ocm
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Ocm UTSW 5 144024534 missense probably damaging 1.00
R4718:Ocm UTSW 5 144024557 missense possibly damaging 0.93
R4803:Ocm UTSW 5 144023868 missense possibly damaging 0.63
R5362:Ocm UTSW 5 144023856 missense probably damaging 1.00
R6842:Ocm UTSW 5 144025691 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGACAGCATACATCCCATC -3'
(R):5'- ACCTGGGGAAAACACTGAGC -3'

Sequencing Primer
(F):5'- CCCACCCATCCACGTTTTGTTG -3'
(R):5'- ACACTGAGCAGAGCCAGG -3'
Posted On2014-11-12