Incidental Mutation 'R2423:Olfr619'
ID 249435
Institutional Source Beutler Lab
Gene Symbol Olfr619
Ensembl Gene ENSMUSG00000073944
Gene Name olfactory receptor 619
Synonyms MOR31-5, GA_x6K02T2PBJ9-6326488-6327450
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103600575-103604859 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103604034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 127 (R127C)
Ref Sequence ENSEMBL: ENSMUSP00000150630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098196] [ENSMUST00000214883] [ENSMUST00000215732] [ENSMUST00000217603]
AlphaFold E9PV95
Predicted Effect probably benign
Transcript: ENSMUST00000098196
AA Change: R127C

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095798
Gene: ENSMUSG00000073944
AA Change: R127C

DomainStartEndE-ValueType
Pfam:7tm_4 36 316 4.4e-106 PFAM
Pfam:7TM_GPCR_Srsx 40 265 5e-10 PFAM
Pfam:7tm_1 46 298 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214883
Predicted Effect probably benign
Transcript: ENSMUST00000215732
AA Change: R127C

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215752
Predicted Effect probably benign
Transcript: ENSMUST00000217603
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Olfr619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Olfr619 APN 7 103604067 missense probably benign 0.23
IGL01806:Olfr619 APN 7 103604341 missense probably benign 0.21
IGL01934:Olfr619 APN 7 103603975 missense probably damaging 1.00
IGL02269:Olfr619 APN 7 103603882 missense probably damaging 0.98
IGL03049:Olfr619 APN 7 103604091 missense probably damaging 0.99
IGL03165:Olfr619 APN 7 103604011 missense probably damaging 0.98
IGL03338:Olfr619 APN 7 103604408 nonsense probably null
R1378:Olfr619 UTSW 7 103603938 nonsense probably null
R1660:Olfr619 UTSW 7 103603675 nonsense probably null
R1975:Olfr619 UTSW 7 103604012 splice site probably null
R1985:Olfr619 UTSW 7 103603672 missense probably benign
R2249:Olfr619 UTSW 7 103603736 missense probably benign 0.00
R4005:Olfr619 UTSW 7 103604263 missense probably damaging 1.00
R4931:Olfr619 UTSW 7 103604374 missense probably benign 0.01
R4939:Olfr619 UTSW 7 103604251 missense probably benign 0.12
R4942:Olfr619 UTSW 7 103604194 missense probably benign
R4970:Olfr619 UTSW 7 103603990 missense probably damaging 0.98
R4993:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
R5254:Olfr619 UTSW 7 103603789 missense probably benign 0.19
R6001:Olfr619 UTSW 7 103603972 missense probably damaging 1.00
R6905:Olfr619 UTSW 7 103604367 missense probably benign
R6985:Olfr619 UTSW 7 103603668 missense probably benign 0.00
R8253:Olfr619 UTSW 7 103604331 missense possibly damaging 0.88
R9124:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAACTATGTTGGCCCTGGC -3'
(R):5'- TATTGACTTTGATGCTGTCACAGG -3'

Sequencing Primer
(F):5'- GGCCGATATCTTCTTGTCCACAG -3'
(R):5'- CCCATGTGTTCACAGTATGAGTGAC -3'
Posted On 2014-11-12