Mutagenetix > Incidental Mutation

Incidental Mutation 'R2423:Neto2'

249440

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

040385-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R2423 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85669767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 83 (R83Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000109686
AA Change: R118Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: R118Q

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

probably damaging
Transcript: ENSMUST00000209479
AA Change: R83Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

probably damaging
Transcript: ENSMUST00000216286
AA Change: R83Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer2	T	C	14: 60,379,207	S284P	possibly damaging	Het
Ap5z1	T	C	5: 142,476,777	V614A	probably benign	Het
Arhgap9	A	T	10: 127,327,124		probably null	Het
Brf1	G	A	12: 113,000,199	A53V	probably benign	Het
Cyp1a2	C	T	9: 57,679,949	R353Q	probably damaging	Het
Deup1	G	T	9: 15,592,458	S269*	probably null	Het
F11r	T	A	1: 171,461,623	Y218N	possibly damaging	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Mapkbp1	A	T	2: 120,024,590	E1430V	probably benign	Het
Mga	A	G	2: 119,964,793	K2986R	probably damaging	Het
Myo9b	G	T	8: 71,327,940	V494L	probably damaging	Het
Nbea	G	A	3: 56,085,306	T293I	probably damaging	Het
Ocm	A	T	5: 144,024,570		probably null	Het
Olfr619	C	T	7: 103,604,034	R127C	probably benign	Het
Pcdha11	T	C	18: 37,007,424	I702T	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rbbp8nl	A	T	2: 180,280,971	S210T	probably damaging	Het
Rbl2	A	T	8: 91,087,146	I340F	probably benign	Het
Rft1	T	C	14: 30,666,767	L216P	possibly damaging	Het
Slc26a10	T	A	10: 127,179,737		probably null	Het
Slc34a1	G	A	13: 55,409,052	A235T	possibly damaging	Het
Spag17	A	G	3: 100,103,456	T2089A	probably benign	Het
Srek1	G	C	13: 103,753,028	S260*	probably null	Het
Sspo	T	C	6: 48,454,055	V624A	probably benign	Het
Tapt1	T	C	5: 44,192,453	I251V	probably benign	Het
Tmem248	T	C	5: 130,229,562	I32T	probably damaging	Het
Tnk1	T	G	11: 69,855,761	T209P	probably damaging	Het
Trip12	TATACATACATACATACATACATACATACATAC	TATACATACATACATACATACATACATACATACATAC	1: 84,814,790		probably null	Het
Trp53tg5	T	A	2: 164,471,330	R142*	probably null	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vldlr	C	T	19: 27,236,288	T125I	possibly damaging	Het
Vps8	A	G	16: 21,559,337	T1033A	probably benign	Het
Wiz	A	C	17: 32,361,885	H197Q	probably damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R3821:Neto2	UTSW	8	85663295	nonsense	probably null
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3883:Neto2	UTSW	8	85663265	missense	probably damaging	1.00
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5544:Neto2	UTSW	8	85647877	missense	possibly damaging	0.94
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6593:Neto2	UTSW	8	85669546	missense	probably damaging	1.00
R6662:Neto2	UTSW	8	85663215	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCGAAATCCTAGTCCTTCAAG -3'
(R):5'- CACAGGGAGATGTTACTGTAATTC -3'

Sequencing Primer
(F):5'- GAAATCCTAGTCCTTCAAGTTCTTC -3'
(R):5'- GGGAGATGTTACTGTAATTCTACAAC -3'

Posted On

2014-11-12