Incidental Mutation 'R2423:Neto2'
ID 249440
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 040385-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86396396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 83 (R83Q)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: R118Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: R118Q

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: R83Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: R83Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,616,656 (GRCm39) S284P possibly damaging Het
Ap5z1 T C 5: 142,462,532 (GRCm39) V614A probably benign Het
Arhgap9 A T 10: 127,162,993 (GRCm39) probably null Het
Brf1 G A 12: 112,963,819 (GRCm39) A53V probably benign Het
Cyp1a2 C T 9: 57,587,232 (GRCm39) R353Q probably damaging Het
Deup1 G T 9: 15,503,754 (GRCm39) S269* probably null Het
F11r T A 1: 171,289,191 (GRCm39) Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Mapkbp1 A T 2: 119,855,071 (GRCm39) E1430V probably benign Het
Mga A G 2: 119,795,274 (GRCm39) K2986R probably damaging Het
Myo9b G T 8: 71,780,584 (GRCm39) V494L probably damaging Het
Nbea G A 3: 55,992,727 (GRCm39) T293I probably damaging Het
Ocm A T 5: 143,961,388 (GRCm39) probably null Het
Or52z14 C T 7: 103,253,241 (GRCm39) R127C probably benign Het
Pcdha11 T C 18: 37,140,477 (GRCm39) I702T possibly damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Rbbp8nl A T 2: 179,922,764 (GRCm39) S210T probably damaging Het
Rbl2 A T 8: 91,813,774 (GRCm39) I340F probably benign Het
Rft1 T C 14: 30,388,724 (GRCm39) L216P possibly damaging Het
Slc26a10 T A 10: 127,015,606 (GRCm39) probably null Het
Slc34a1 G A 13: 55,556,865 (GRCm39) A235T possibly damaging Het
Spag17 A G 3: 100,010,772 (GRCm39) T2089A probably benign Het
Srek1 G C 13: 103,889,536 (GRCm39) S260* probably null Het
Sspo T C 6: 48,430,989 (GRCm39) V624A probably benign Het
Tapt1 T C 5: 44,349,795 (GRCm39) I251V probably benign Het
Tmem248 T C 5: 130,258,403 (GRCm39) I32T probably damaging Het
Tnk1 T G 11: 69,746,587 (GRCm39) T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,792,511 (GRCm39) probably null Het
Trp53tg5 T A 2: 164,313,250 (GRCm39) R142* probably null Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Vldlr C T 19: 27,213,688 (GRCm39) T125I possibly damaging Het
Vps8 A G 16: 21,378,087 (GRCm39) T1033A probably benign Het
Wiz A C 17: 32,580,859 (GRCm39) H197Q probably damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCGAAATCCTAGTCCTTCAAG -3'
(R):5'- CACAGGGAGATGTTACTGTAATTC -3'

Sequencing Primer
(F):5'- GAAATCCTAGTCCTTCAAGTTCTTC -3'
(R):5'- GGGAGATGTTACTGTAATTCTACAAC -3'
Posted On 2014-11-12