Mutagenetix > Incidental Mutations

Incidental Mutation 'R2423:Rbl2'

249441

Institutional Source

Beutler Lab

Gene Symbol

Rbl2

Ensembl Gene

ENSMUSG00000031666

Gene Name

RB transcriptional corepressor like 2

Synonyms

p130, Rb2

MMRRC Submission

040385-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2423 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91070057-91123844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91087146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 340 (I340F)

Ref Sequence

ENSEMBL: ENSMUSP00000147579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000209518] [ENSMUST00000211136]

AlphaFold

Q64700

Predicted Effect

probably benign
Transcript: ENSMUST00000034091
AA Change: I383F

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: I383F

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CYCLIN	44	131	5.81e-1	SMART
DUF3452	94	236	2.36e-77	SMART
low complexity region	301	313	N/A	INTRINSIC
RB_A	414	606	3.42e-106	SMART
low complexity region	722	733	N/A	INTRINSIC
low complexity region	758	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
CYCLIN	845	1008	2.86e-6	SMART
Rb_C	1019	1135	5.42e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209518
AA Change: I383F

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000211136
AA Change: I340F

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer2	T	C	14: 60,379,207	S284P	possibly damaging	Het
Ap5z1	T	C	5: 142,476,777	V614A	probably benign	Het
Arhgap9	A	T	10: 127,327,124		probably null	Het
Brf1	G	A	12: 113,000,199	A53V	probably benign	Het
Cyp1a2	C	T	9: 57,679,949	R353Q	probably damaging	Het
Deup1	G	T	9: 15,592,458	S269*	probably null	Het
F11r	T	A	1: 171,461,623	Y218N	possibly damaging	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Mapkbp1	A	T	2: 120,024,590	E1430V	probably benign	Het
Mga	A	G	2: 119,964,793	K2986R	probably damaging	Het
Myo9b	G	T	8: 71,327,940	V494L	probably damaging	Het
Nbea	G	A	3: 56,085,306	T293I	probably damaging	Het
Neto2	C	T	8: 85,669,767	R83Q	probably damaging	Het
Ocm	A	T	5: 144,024,570		probably null	Het
Olfr619	C	T	7: 103,604,034	R127C	probably benign	Het
Pcdha11	T	C	18: 37,007,424	I702T	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rbbp8nl	A	T	2: 180,280,971	S210T	probably damaging	Het
Rft1	T	C	14: 30,666,767	L216P	possibly damaging	Het
Slc26a10	T	A	10: 127,179,737		probably null	Het
Slc34a1	G	A	13: 55,409,052	A235T	possibly damaging	Het
Spag17	A	G	3: 100,103,456	T2089A	probably benign	Het
Srek1	G	C	13: 103,753,028	S260*	probably null	Het
Sspo	T	C	6: 48,454,055	V624A	probably benign	Het
Tapt1	T	C	5: 44,192,453	I251V	probably benign	Het
Tmem248	T	C	5: 130,229,562	I32T	probably damaging	Het
Tnk1	T	G	11: 69,855,761	T209P	probably damaging	Het
Trip12	TATACATACATACATACATACATACATACATAC	TATACATACATACATACATACATACATACATACATAC	1: 84,814,790		probably null	Het
Trp53tg5	T	A	2: 164,471,330	R142*	probably null	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vldlr	C	T	19: 27,236,288	T125I	possibly damaging	Het
Vps8	A	G	16: 21,559,337	T1033A	probably benign	Het
Wiz	A	C	17: 32,361,885	H197Q	probably damaging	Het

Other mutations in Rbl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Rbl2	APN	8	91085445	missense	probably damaging	1.00
IGL01084:Rbl2	APN	8	91122313	missense	probably damaging	0.99
IGL01317:Rbl2	APN	8	91100057	missense	probably damaging	1.00
IGL01637:Rbl2	APN	8	91106438	missense	probably benign
IGL01843:Rbl2	APN	8	91090216	missense	probably benign	0.11
IGL01884:Rbl2	APN	8	91096836	missense	probably damaging	1.00
IGL02071:Rbl2	APN	8	91102198	missense	probably damaging	1.00
IGL02588:Rbl2	APN	8	91087084	missense	probably damaging	0.99
IGL03027:Rbl2	APN	8	91078906	missense	possibly damaging	0.92
IGL03162:Rbl2	APN	8	91085702	missense	probably benign	0.01
IGL03200:Rbl2	APN	8	91096767	missense	probably benign	0.00
R0165:Rbl2	UTSW	8	91074176	missense	probably damaging	1.00
R0238:Rbl2	UTSW	8	91106507	missense	probably damaging	0.99
R0238:Rbl2	UTSW	8	91106507	missense	probably damaging	0.99
R0317:Rbl2	UTSW	8	91087144	missense	probably benign	0.00
R0539:Rbl2	UTSW	8	91112505	splice site	probably benign
R1532:Rbl2	UTSW	8	91106417	missense	probably benign	0.01
R1696:Rbl2	UTSW	8	91085724	missense	probably benign	0.12
R1852:Rbl2	UTSW	8	91095563	missense	possibly damaging	0.84
R1866:Rbl2	UTSW	8	91112529	missense	probably benign	0.00
R1975:Rbl2	UTSW	8	91085462	missense	probably benign
R2062:Rbl2	UTSW	8	91106739	missense	probably damaging	1.00
R2180:Rbl2	UTSW	8	91090055	missense	possibly damaging	0.51
R3109:Rbl2	UTSW	8	91102235	missense	probably benign
R4356:Rbl2	UTSW	8	91107107	missense	probably damaging	0.97
R4692:Rbl2	UTSW	8	91122419	missense	probably damaging	1.00
R4707:Rbl2	UTSW	8	91085568	missense	probably damaging	1.00
R4784:Rbl2	UTSW	8	91085568	missense	probably damaging	1.00
R5084:Rbl2	UTSW	8	91115131	missense	probably benign	0.43
R5432:Rbl2	UTSW	8	91102283	missense	probably benign	0.01
R5493:Rbl2	UTSW	8	91115819	missense	probably damaging	1.00
R5546:Rbl2	UTSW	8	91078932	missense	probably benign	0.00
R5918:Rbl2	UTSW	8	91090130	missense	probably benign	0.02
R6186:Rbl2	UTSW	8	91106730	missense	probably damaging	1.00
R6257:Rbl2	UTSW	8	91115678	missense	probably damaging	1.00
R6526:Rbl2	UTSW	8	91096839	missense	probably benign	0.04
R6546:Rbl2	UTSW	8	91070370	missense	probably benign
R6714:Rbl2	UTSW	8	91106787	missense	possibly damaging	0.91
R7214:Rbl2	UTSW	8	91083429	critical splice donor site	probably null
R7286:Rbl2	UTSW	8	91102294	nonsense	probably null
R7290:Rbl2	UTSW	8	91115041	missense	probably benign	0.33
R7315:Rbl2	UTSW	8	91076012	missense	probably damaging	0.96
R7524:Rbl2	UTSW	8	91115193	missense	probably benign
R8060:Rbl2	UTSW	8	91096869	critical splice donor site	probably null
R8071:Rbl2	UTSW	8	91113989	missense	probably damaging	1.00
R8154:Rbl2	UTSW	8	91107197	missense	probably damaging	1.00
R8302:Rbl2	UTSW	8	91085445	missense	probably damaging	1.00
R8344:Rbl2	UTSW	8	91115759	missense	possibly damaging	0.89
R8724:Rbl2	UTSW	8	91115209	missense	possibly damaging	0.54
R8822:Rbl2	UTSW	8	91106718	missense	possibly damaging	0.95
R9186:Rbl2	UTSW	8	91101378	missense	probably damaging	1.00
X0023:Rbl2	UTSW	8	91090079	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTGTTTCCCCATAGTAAGGCC -3'
(R):5'- AGCAGGACGCATCTGTTTCG -3'

Sequencing Primer
(F):5'- TCCCCATAGTAAGGCCGTTAATAAGG -3'
(R):5'- GCAGGACGCATCTGTTTCGATTAAC -3'

Posted On

2014-11-12