Incidental Mutation 'R2423:Rbl2'
ID 249441
Institutional Source Beutler Lab
Gene Symbol Rbl2
Ensembl Gene ENSMUSG00000031666
Gene Name RB transcriptional corepressor like 2
Synonyms p130, Rb2
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 91070057-91123844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91087146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 340 (I340F)
Ref Sequence ENSEMBL: ENSMUSP00000147579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000209518] [ENSMUST00000211136]
AlphaFold Q64700
Predicted Effect probably benign
Transcript: ENSMUST00000034091
AA Change: I383F

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: I383F

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209518
AA Change: I383F

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000211136
AA Change: I340F

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Rbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rbl2 APN 8 91085445 missense probably damaging 1.00
IGL01084:Rbl2 APN 8 91122313 missense probably damaging 0.99
IGL01317:Rbl2 APN 8 91100057 missense probably damaging 1.00
IGL01637:Rbl2 APN 8 91106438 missense probably benign
IGL01843:Rbl2 APN 8 91090216 missense probably benign 0.11
IGL01884:Rbl2 APN 8 91096836 missense probably damaging 1.00
IGL02071:Rbl2 APN 8 91102198 missense probably damaging 1.00
IGL02588:Rbl2 APN 8 91087084 missense probably damaging 0.99
IGL03027:Rbl2 APN 8 91078906 missense possibly damaging 0.92
IGL03162:Rbl2 APN 8 91085702 missense probably benign 0.01
IGL03200:Rbl2 APN 8 91096767 missense probably benign 0.00
R0165:Rbl2 UTSW 8 91074176 missense probably damaging 1.00
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0317:Rbl2 UTSW 8 91087144 missense probably benign 0.00
R0539:Rbl2 UTSW 8 91112505 splice site probably benign
R1532:Rbl2 UTSW 8 91106417 missense probably benign 0.01
R1696:Rbl2 UTSW 8 91085724 missense probably benign 0.12
R1852:Rbl2 UTSW 8 91095563 missense possibly damaging 0.84
R1866:Rbl2 UTSW 8 91112529 missense probably benign 0.00
R1975:Rbl2 UTSW 8 91085462 missense probably benign
R2062:Rbl2 UTSW 8 91106739 missense probably damaging 1.00
R2180:Rbl2 UTSW 8 91090055 missense possibly damaging 0.51
R3109:Rbl2 UTSW 8 91102235 missense probably benign
R4356:Rbl2 UTSW 8 91107107 missense probably damaging 0.97
R4692:Rbl2 UTSW 8 91122419 missense probably damaging 1.00
R4707:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R4784:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R5084:Rbl2 UTSW 8 91115131 missense probably benign 0.43
R5432:Rbl2 UTSW 8 91102283 missense probably benign 0.01
R5493:Rbl2 UTSW 8 91115819 missense probably damaging 1.00
R5546:Rbl2 UTSW 8 91078932 missense probably benign 0.00
R5918:Rbl2 UTSW 8 91090130 missense probably benign 0.02
R6186:Rbl2 UTSW 8 91106730 missense probably damaging 1.00
R6257:Rbl2 UTSW 8 91115678 missense probably damaging 1.00
R6526:Rbl2 UTSW 8 91096839 missense probably benign 0.04
R6546:Rbl2 UTSW 8 91070370 missense probably benign
R6714:Rbl2 UTSW 8 91106787 missense possibly damaging 0.91
R7214:Rbl2 UTSW 8 91083429 critical splice donor site probably null
R7286:Rbl2 UTSW 8 91102294 nonsense probably null
R7290:Rbl2 UTSW 8 91115041 missense probably benign 0.33
R7315:Rbl2 UTSW 8 91076012 missense probably damaging 0.96
R7524:Rbl2 UTSW 8 91115193 missense probably benign
R8060:Rbl2 UTSW 8 91096869 critical splice donor site probably null
R8071:Rbl2 UTSW 8 91113989 missense probably damaging 1.00
R8154:Rbl2 UTSW 8 91107197 missense probably damaging 1.00
R8302:Rbl2 UTSW 8 91085445 missense probably damaging 1.00
R8344:Rbl2 UTSW 8 91115759 missense possibly damaging 0.89
R8724:Rbl2 UTSW 8 91115209 missense possibly damaging 0.54
R8822:Rbl2 UTSW 8 91106718 missense possibly damaging 0.95
R9186:Rbl2 UTSW 8 91101378 missense probably damaging 1.00
X0023:Rbl2 UTSW 8 91090079 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTTTCCCCATAGTAAGGCC -3'
(R):5'- AGCAGGACGCATCTGTTTCG -3'

Sequencing Primer
(F):5'- TCCCCATAGTAAGGCCGTTAATAAGG -3'
(R):5'- GCAGGACGCATCTGTTTCGATTAAC -3'
Posted On 2014-11-12