Mutagenetix > Incidental Mutations

Incidental Mutation 'R2423:Deup1'

249442

Institutional Source

Beutler Lab

Gene Symbol

Deup1

Ensembl Gene

ENSMUSG00000039977

Gene Name

deuterosome assembly protein 1

Synonyms

Ccdc67, 4933401K09Rik

MMRRC Submission

040385-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2423 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15559864-15627933 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 15592458 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 269 (S269*)

Ref Sequence

ENSEMBL: ENSMUSP00000121526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]

Predicted Effect

probably null
Transcript: ENSMUST00000045513
AA Change: S269*

SMART Domains

Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: S269*

Domain	Start	End	E-Value	Type
Pfam:CEP63	11	279	7.7e-92	PFAM
low complexity region	286	299	N/A	INTRINSIC
coiled coil region	353	397	N/A	INTRINSIC
coiled coil region	555	586	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115592
AA Change: S269*

SMART Domains

Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: S269*

Domain	Start	End	E-Value	Type
coiled coil region	29	59	N/A	INTRINSIC
coiled coil region	166	196	N/A	INTRINSIC
coiled coil region	226	277	N/A	INTRINSIC
low complexity region	286	299	N/A	INTRINSIC
coiled coil region	461	492	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115593
AA Change: S269*

SMART Domains

Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: S269*

Domain	Start	End	E-Value	Type
coiled coil region	29	59	N/A	INTRINSIC
coiled coil region	166	196	N/A	INTRINSIC
coiled coil region	226	277	N/A	INTRINSIC
low complexity region	286	299	N/A	INTRINSIC
coiled coil region	461	492	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137164

Predicted Effect

probably null
Transcript: ENSMUST00000152377
AA Change: S269*

SMART Domains

Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977
AA Change: S269*

Domain	Start	End	E-Value	Type
coiled coil region	29	59	N/A	INTRINSIC
coiled coil region	166	196	N/A	INTRINSIC
coiled coil region	226	277	N/A	INTRINSIC
low complexity region	286	299	N/A	INTRINSIC
coiled coil region	353	397	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer2	T	C	14: 60,379,207	S284P	possibly damaging	Het
Ap5z1	T	C	5: 142,476,777	V614A	probably benign	Het
Arhgap9	A	T	10: 127,327,124		probably null	Het
Brf1	G	A	12: 113,000,199	A53V	probably benign	Het
Cyp1a2	C	T	9: 57,679,949	R353Q	probably damaging	Het
F11r	T	A	1: 171,461,623	Y218N	possibly damaging	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Mapkbp1	A	T	2: 120,024,590	E1430V	probably benign	Het
Mga	A	G	2: 119,964,793	K2986R	probably damaging	Het
Myo9b	G	T	8: 71,327,940	V494L	probably damaging	Het
Nbea	G	A	3: 56,085,306	T293I	probably damaging	Het
Neto2	C	T	8: 85,669,767	R83Q	probably damaging	Het
Ocm	A	T	5: 144,024,570		probably null	Het
Olfr619	C	T	7: 103,604,034	R127C	probably benign	Het
Pcdha11	T	C	18: 37,007,424	I702T	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rbbp8nl	A	T	2: 180,280,971	S210T	probably damaging	Het
Rbl2	A	T	8: 91,087,146	I340F	probably benign	Het
Rft1	T	C	14: 30,666,767	L216P	possibly damaging	Het
Slc26a10	T	A	10: 127,179,737		probably null	Het
Slc34a1	G	A	13: 55,409,052	A235T	possibly damaging	Het
Spag17	A	G	3: 100,103,456	T2089A	probably benign	Het
Srek1	G	C	13: 103,753,028	S260*	probably null	Het
Sspo	T	C	6: 48,454,055	V624A	probably benign	Het
Tapt1	T	C	5: 44,192,453	I251V	probably benign	Het
Tmem248	T	C	5: 130,229,562	I32T	probably damaging	Het
Tnk1	T	G	11: 69,855,761	T209P	probably damaging	Het
Trip12	TATACATACATACATACATACATACATACATAC	TATACATACATACATACATACATACATACATACATAC	1: 84,814,790		probably null	Het
Trp53tg5	T	A	2: 164,471,330	R142*	probably null	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vldlr	C	T	19: 27,236,288	T125I	possibly damaging	Het
Vps8	A	G	16: 21,559,337	T1033A	probably benign	Het
Wiz	A	C	17: 32,361,885	H197Q	probably damaging	Het

Other mutations in Deup1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Deup1	APN	9	15561370	missense	probably damaging	0.96
IGL00927:Deup1	APN	9	15610671	splice site	probably benign
IGL00946:Deup1	APN	9	15561238	missense	possibly damaging	0.62
IGL02458:Deup1	APN	9	15592360	missense	probably benign	0.02
IGL02567:Deup1	APN	9	15575283	missense	probably damaging	1.00
IGL03089:Deup1	APN	9	15607800	missense	possibly damaging	0.62
IGL03220:Deup1	APN	9	15592411	missense	probably benign	0.38
IGL03147:Deup1	UTSW	9	15610614	missense	probably damaging	0.99
PIT4468001:Deup1	UTSW	9	15564005	missense	possibly damaging	0.79
R0035:Deup1	UTSW	9	15599821	missense	possibly damaging	0.89
R0035:Deup1	UTSW	9	15599821	missense	possibly damaging	0.89
R0324:Deup1	UTSW	9	15582533	missense	probably benign	0.01
R0539:Deup1	UTSW	9	15582597	missense	possibly damaging	0.51
R0835:Deup1	UTSW	9	15599751	missense	probably damaging	1.00
R1666:Deup1	UTSW	9	15575191	missense	possibly damaging	0.92
R2212:Deup1	UTSW	9	15599843	missense	probably benign	0.00
R2237:Deup1	UTSW	9	15575301	missense	probably damaging	1.00
R2238:Deup1	UTSW	9	15575301	missense	probably damaging	1.00
R2929:Deup1	UTSW	9	15575188	missense	probably benign	0.03
R3890:Deup1	UTSW	9	15599713	missense	probably damaging	1.00
R3892:Deup1	UTSW	9	15599713	missense	probably damaging	1.00
R4941:Deup1	UTSW	9	15588027	missense	probably benign
R4959:Deup1	UTSW	9	15612014	nonsense	probably null
R4960:Deup1	UTSW	9	15600968	missense	possibly damaging	0.87
R4968:Deup1	UTSW	9	15592428	missense	probably damaging	0.99
R4973:Deup1	UTSW	9	15612014	nonsense	probably null
R5195:Deup1	UTSW	9	15575191	missense	possibly damaging	0.92
R5231:Deup1	UTSW	9	15575199	missense	probably damaging	0.96
R5470:Deup1	UTSW	9	15582620	splice site	probably null
R5931:Deup1	UTSW	9	15561322	missense	possibly damaging	0.55
R6049:Deup1	UTSW	9	15561256	missense	possibly damaging	0.75
R6373:Deup1	UTSW	9	15561342	missense	probably damaging	0.99
R6516:Deup1	UTSW	9	15610614	missense	probably damaging	0.99
R7948:Deup1	UTSW	9	15610648	missense	possibly damaging	0.76
Z1177:Deup1	UTSW	9	15600903	missense	probably null	1.00
Z1177:Deup1	UTSW	9	15607832	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CACACATCCTGCACACCTGT -3'
(R):5'- CACTCAGGGTCATCCATTAGGT -3'

Sequencing Primer
(F):5'- TTTACATACATGTATCCTGCACACAC -3'
(R):5'- GGCAGCCTGAATAGCACATTCTG -3'

Posted On

2014-11-12