Incidental Mutation 'R2423:Arhgap9'
ID 249446
Institutional Source Beutler Lab
Gene Symbol Arhgap9
Ensembl Gene ENSMUSG00000040345
Gene Name Rho GTPase activating protein 9
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 127321964-127329943 bp(+) (GRCm38)
Type of Mutation splice site (2758 bp from exon)
DNA Base Change (assembly) A to T at 127327124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
AlphaFold Q1HDU4
Predicted Effect probably null
Transcript: ENSMUST00000026474
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069548
AA Change: N233Y

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345
AA Change: N233Y

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218656
Predicted Effect possibly damaging
Transcript: ENSMUST00000219026
AA Change: N233Y

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219511
AA Change: N408Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Arhgap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Arhgap9 APN 10 127327893 splice site probably benign
IGL01069:Arhgap9 APN 10 127328952 missense probably damaging 1.00
IGL02444:Arhgap9 APN 10 127327947 missense probably damaging 1.00
IGL02707:Arhgap9 APN 10 127329607 missense probably damaging 0.98
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0841:Arhgap9 UTSW 10 127329639 missense probably damaging 0.98
R1084:Arhgap9 UTSW 10 127327928 missense probably damaging 1.00
R1707:Arhgap9 UTSW 10 127328889 missense probably benign 0.00
R1799:Arhgap9 UTSW 10 127327724 missense probably damaging 1.00
R2511:Arhgap9 UTSW 10 127328985 critical splice donor site probably null
R3721:Arhgap9 UTSW 10 127328971 missense possibly damaging 0.84
R3803:Arhgap9 UTSW 10 127329517 missense possibly damaging 0.64
R4261:Arhgap9 UTSW 10 127328465 missense probably damaging 1.00
R4968:Arhgap9 UTSW 10 127327006 missense possibly damaging 0.80
R5423:Arhgap9 UTSW 10 127329549 missense probably damaging 1.00
R5425:Arhgap9 UTSW 10 127326418 missense probably damaging 1.00
R6697:Arhgap9 UTSW 10 127322120 missense probably benign 0.34
R6969:Arhgap9 UTSW 10 127326643 missense probably benign 0.39
R8840:Arhgap9 UTSW 10 127325140 missense possibly damaging 0.94
R8844:Arhgap9 UTSW 10 127325146 missense probably benign 0.03
R9084:Arhgap9 UTSW 10 127322245 missense possibly damaging 0.95
R9325:Arhgap9 UTSW 10 127325853 missense probably damaging 1.00
X0067:Arhgap9 UTSW 10 127328432 missense probably damaging 1.00
Z1176:Arhgap9 UTSW 10 127327689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAATCGGAACCGGTGTC -3'
(R):5'- GAGCCTCACTAGAGTTTTAGTTAATGC -3'

Sequencing Primer
(F):5'- AATCGGAACCGGTGTCCAAGTC -3'
(R):5'- TGACTTATCAGGCCAGGCATG -3'
Posted On 2014-11-12