Mutagenetix > Incidental Mutations

Incidental Mutation 'R2423:Slc34a1'

249450

Institutional Source

Beutler Lab

Gene Symbol

Slc34a1

Ensembl Gene

ENSMUSG00000021490

Gene Name

solute carrier family 34 (sodium phosphate), member 1

Synonyms

Na/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter

MMRRC Submission

040385-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2423 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55398187-55415592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55409052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 235 (A235T)

Ref Sequence

ENSEMBL: ENSMUSP00000152974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057167] [ENSMUST00000224925] [ENSMUST00000225259]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057167
AA Change: A354T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490
AA Change: A354T

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	113	256	7.4e-28	PFAM
Pfam:Na_Pi_cotrans	359	549	2.3e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224043

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224925
AA Change: A235T

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000225259
AA Change: A354T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225538

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer2	T	C	14: 60,379,207	S284P	possibly damaging	Het
Ap5z1	T	C	5: 142,476,777	V614A	probably benign	Het
Arhgap9	A	T	10: 127,327,124		probably null	Het
Brf1	G	A	12: 113,000,199	A53V	probably benign	Het
Cyp1a2	C	T	9: 57,679,949	R353Q	probably damaging	Het
Deup1	G	T	9: 15,592,458	S269*	probably null	Het
F11r	T	A	1: 171,461,623	Y218N	possibly damaging	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Mapkbp1	A	T	2: 120,024,590	E1430V	probably benign	Het
Mga	A	G	2: 119,964,793	K2986R	probably damaging	Het
Myo9b	G	T	8: 71,327,940	V494L	probably damaging	Het
Nbea	G	A	3: 56,085,306	T293I	probably damaging	Het
Neto2	C	T	8: 85,669,767	R83Q	probably damaging	Het
Ocm	A	T	5: 144,024,570		probably null	Het
Olfr619	C	T	7: 103,604,034	R127C	probably benign	Het
Pcdha11	T	C	18: 37,007,424	I702T	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rbbp8nl	A	T	2: 180,280,971	S210T	probably damaging	Het
Rbl2	A	T	8: 91,087,146	I340F	probably benign	Het
Rft1	T	C	14: 30,666,767	L216P	possibly damaging	Het
Slc26a10	T	A	10: 127,179,737		probably null	Het
Spag17	A	G	3: 100,103,456	T2089A	probably benign	Het
Srek1	G	C	13: 103,753,028	S260*	probably null	Het
Sspo	T	C	6: 48,454,055	V624A	probably benign	Het
Tapt1	T	C	5: 44,192,453	I251V	probably benign	Het
Tmem248	T	C	5: 130,229,562	I32T	probably damaging	Het
Tnk1	T	G	11: 69,855,761	T209P	probably damaging	Het
Trip12	TATACATACATACATACATACATACATACATAC	TATACATACATACATACATACATACATACATACATAC	1: 84,814,790		probably null	Het
Trp53tg5	T	A	2: 164,471,330	R142*	probably null	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vldlr	C	T	19: 27,236,288	T125I	possibly damaging	Het
Vps8	A	G	16: 21,559,337	T1033A	probably benign	Het
Wiz	A	C	17: 32,361,885	H197Q	probably damaging	Het

Other mutations in Slc34a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Slc34a1	APN	13	55409071	missense	probably damaging	1.00
IGL01396:Slc34a1	APN	13	55402733	missense	probably damaging	1.00
IGL01405:Slc34a1	APN	13	55412128	missense	probably damaging	1.00
IGL02525:Slc34a1	APN	13	55403238	splice site	probably benign
IGL02555:Slc34a1	APN	13	55401168	missense	possibly damaging	0.77
IGL02692:Slc34a1	APN	13	55403236	splice site	probably benign
IGL03173:Slc34a1	APN	13	55413276	missense	probably damaging	0.99
IGL03221:Slc34a1	APN	13	55400778	missense	probably benign	0.00
R0190:Slc34a1	UTSW	13	55409101	missense	probably benign	0.00
R0196:Slc34a1	UTSW	13	55412265	missense	probably damaging	0.99
R0362:Slc34a1	UTSW	13	55402898	splice site	probably null
R1055:Slc34a1	UTSW	13	55403033	missense	probably benign	0.26
R1243:Slc34a1	UTSW	13	55412131	missense	possibly damaging	0.85
R1414:Slc34a1	UTSW	13	55400711	missense	probably benign
R1566:Slc34a1	UTSW	13	55412031	critical splice acceptor site	probably null
R1732:Slc34a1	UTSW	13	55413420	missense	probably benign
R1901:Slc34a1	UTSW	13	55401150	nonsense	probably null
R2986:Slc34a1	UTSW	13	55403329	missense	probably benign	0.00
R3940:Slc34a1	UTSW	13	55413170	missense	probably damaging	1.00
R4003:Slc34a1	UTSW	13	55402661	splice site	probably benign
R4553:Slc34a1	UTSW	13	55412061	splice site	probably null
R4735:Slc34a1	UTSW	13	55413584	missense	probably benign	0.13
R5177:Slc34a1	UTSW	13	55401162	missense	probably damaging	0.99
R5345:Slc34a1	UTSW	13	55400518	missense	probably benign
R5363:Slc34a1	UTSW	13	55403268	missense	probably benign	0.16
R5363:Slc34a1	UTSW	13	55412290	missense	probably damaging	1.00
R5668:Slc34a1	UTSW	13	55409085	missense	possibly damaging	0.94
R5685:Slc34a1	UTSW	13	55401272	critical splice donor site	probably null
R5782:Slc34a1	UTSW	13	55402688	missense	possibly damaging	0.92
R5836:Slc34a1	UTSW	13	55413465	missense	probably benign	0.05
R6047:Slc34a1	UTSW	13	55412071	missense	probably damaging	1.00
R6496:Slc34a1	UTSW	13	55402682	missense	probably benign	0.15
R7158:Slc34a1	UTSW	13	55401231	missense	probably damaging	0.99
R7384:Slc34a1	UTSW	13	55402934	missense	probably benign	0.00
R7694:Slc34a1	UTSW	13	55413408	missense	probably benign	0.22
R8977:Slc34a1	UTSW	13	55409002	missense	probably benign	0.01
X0022:Slc34a1	UTSW	13	55403015	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCTAACATCTGGGCTTACGG -3'
(R):5'- AACCTGAGGTTTACAGATGATAGTG -3'

Sequencing Primer
(F):5'- TTACGGAGTCCCTGGTGCAG -3'
(R):5'- GGTGAATTTAACGACACCCAG -3'

Posted On

2014-11-12