Incidental Mutation 'R2423:Srek1'
ID 249451
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Name splicing regulatory glutamine/lysine-rich protein 1
Synonyms SRrp508, Sfrs12, SRrp86
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 103739348-103774608 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to C at 103753028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 260 (S260*)
Ref Sequence ENSEMBL: ENSMUSP00000148039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000210489] [ENSMUST00000210836] [ENSMUST00000211322]
AlphaFold Q8BZX4
Predicted Effect probably null
Transcript: ENSMUST00000074616
AA Change: S376*
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621
AA Change: S376*

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210269
Predicted Effect probably null
Transcript: ENSMUST00000210489
AA Change: S260*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210643
Predicted Effect probably benign
Transcript: ENSMUST00000210836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211030
Predicted Effect probably null
Transcript: ENSMUST00000211322
AA Change: S260*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211491
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103760582 missense probably damaging 1.00
IGL01834:Srek1 APN 13 103748785 unclassified probably benign
IGL03029:Srek1 APN 13 103763960 utr 5 prime probably benign
IGL03198:Srek1 APN 13 103744935 splice site probably null
IGL03284:Srek1 APN 13 103760537 missense probably damaging 0.96
inscruitable UTSW 13 103774386 missense probably damaging 1.00
PIT4453001:Srek1 UTSW 13 103744783 critical splice donor site probably null
R0080:Srek1 UTSW 13 103743686 missense unknown
R0082:Srek1 UTSW 13 103743686 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0506:Srek1 UTSW 13 103760590 missense probably damaging 0.99
R0569:Srek1 UTSW 13 103748862 unclassified probably benign
R0969:Srek1 UTSW 13 103752503 unclassified probably benign
R1617:Srek1 UTSW 13 103743604 missense unknown
R2098:Srek1 UTSW 13 103744855 missense unknown
R3950:Srek1 UTSW 13 103744895 missense unknown
R4347:Srek1 UTSW 13 103748759 missense probably null
R4676:Srek1 UTSW 13 103758187 splice site probably benign
R4915:Srek1 UTSW 13 103752563 unclassified probably benign
R4915:Srek1 UTSW 13 103752686 utr 3 prime probably benign
R5119:Srek1 UTSW 13 103752556 unclassified probably benign
R5677:Srek1 UTSW 13 103759244 missense probably damaging 0.98
R6135:Srek1 UTSW 13 103774386 missense probably damaging 1.00
R6458:Srek1 UTSW 13 103743568 missense probably benign 0.01
R7406:Srek1 UTSW 13 103769382 missense probably damaging 1.00
R8537:Srek1 UTSW 13 103752449 unclassified probably benign
R9269:Srek1 UTSW 13 103753146 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTAAGCTGAACCACACTG -3'
(R):5'- CCCTGACAATACTATGCCTGAC -3'

Sequencing Primer
(F):5'- GGCCATATTTGCATCAGAGC -3'
(R):5'- ATACTATGCCTGACAGAGAAAATAAC -3'
Posted On 2014-11-12