Incidental Mutation 'R2423:Gjd4'
ID 249456
Institutional Source Beutler Lab
Gene Symbol Gjd4
Ensembl Gene ENSMUSG00000036855
Gene Name gap junction protein, delta 4
Synonyms Cx39, connexin 39, 9430022F06Rik
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 9278607-9282809 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 9280811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 89 (S89*)
Ref Sequence ENSEMBL: ENSMUSP00000035472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041007]
AlphaFold Q8BSD4
Predicted Effect probably null
Transcript: ENSMUST00000041007
AA Change: S89*
SMART Domains Protein: ENSMUSP00000035472
Gene: ENSMUSG00000036855
AA Change: S89*

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
CNX 43 76 4.18e-13 SMART
Connexin_CCC 131 197 1.23e-28 SMART
low complexity region 237 251 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Connexins, such as GJD4, are involved in the formation of gap junctions, intercellular conduits that directly connect the cytoplasms of contacting cells. Each gap junction channel is formed by docking of 2 hemichannels, each of which contains 6 connexin subunits (Sohl et al., 2003 [PubMed 12881038]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated muscle regeneration following BaCl2 injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Gjd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0046:Gjd4 UTSW 18 9280998 missense probably damaging 0.98
R0046:Gjd4 UTSW 18 9280998 missense probably damaging 0.98
R0157:Gjd4 UTSW 18 9280549 missense probably benign 0.00
R0348:Gjd4 UTSW 18 9280964 missense possibly damaging 0.77
R0538:Gjd4 UTSW 18 9280244 missense probably benign 0.00
R1536:Gjd4 UTSW 18 9280569 missense probably damaging 1.00
R2425:Gjd4 UTSW 18 9280811 nonsense probably null
R3031:Gjd4 UTSW 18 9280811 nonsense probably null
R3508:Gjd4 UTSW 18 9280811 nonsense probably null
R4154:Gjd4 UTSW 18 9280811 nonsense probably null
R4675:Gjd4 UTSW 18 9280578 missense probably damaging 1.00
R5255:Gjd4 UTSW 18 9280613 missense probably benign 0.00
R6452:Gjd4 UTSW 18 9280457 missense possibly damaging 0.91
R7002:Gjd4 UTSW 18 9280960 missense possibly damaging 0.88
R7077:Gjd4 UTSW 18 9280928 missense probably damaging 1.00
R7232:Gjd4 UTSW 18 9280380 missense probably damaging 1.00
R7250:Gjd4 UTSW 18 9280391 missense probably benign 0.03
R7355:Gjd4 UTSW 18 9280860 missense probably damaging 1.00
R8398:Gjd4 UTSW 18 9280326 missense possibly damaging 0.51
R9147:Gjd4 UTSW 18 9280095 missense probably benign 0.01
R9148:Gjd4 UTSW 18 9280095 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTACATGCGAGCAAGACAC -3'
(R):5'- CTGTCCTAGGCATGATCTGG -3'

Sequencing Primer
(F):5'- CGAGCAAGACACGCGGG -3'
(R):5'- ATCTGGCTGATCGTGGAGGTC -3'
Posted On 2014-11-12