Incidental Mutation 'R0308:Hipk3'
ID24946
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Namehomeodomain interacting protein kinase 3
SynonymsDYRK6, FIST3
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104426481-104494446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104433207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 900 (S900L)
Ref Sequence ENSEMBL: ENSMUSP00000106753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: S900L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: S900L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: S900L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: S900L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111125
AA Change: S921L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: S921L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132622
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104430231 missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104433172 missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104437089 missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104471853 splice site probably benign
IGL01932:Hipk3 APN 2 104470981 missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104431379 missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104471331 missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104471412 missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104471259 missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104433741 missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104439293 missense probably benign 0.02
R0277:Hipk3 UTSW 2 104441248 missense probably damaging 1.00
R0367:Hipk3 UTSW 2 104431249 nonsense probably null
R0597:Hipk3 UTSW 2 104433637 missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104471698 missense probably benign 0.00
R1171:Hipk3 UTSW 2 104471676 missense probably benign 0.02
R1244:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104441262 missense probably benign 0.01
R1616:Hipk3 UTSW 2 104433745 nonsense probably null
R1893:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104430188 missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104433841 missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104471173 missense probably benign 0.00
R1985:Hipk3 UTSW 2 104434435 missense probably benign 0.16
R2105:Hipk3 UTSW 2 104439392 missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104471485 missense probably benign 0.01
R3028:Hipk3 UTSW 2 104433790 missense probably benign
R3747:Hipk3 UTSW 2 104441283 nonsense probably null
R3923:Hipk3 UTSW 2 104470762 missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104441277 missense probably benign 0.01
R4604:Hipk3 UTSW 2 104439329 missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104433759 missense probably benign 0.00
R5193:Hipk3 UTSW 2 104430000 missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104434953 missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104440224 missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104471808 missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104471184 missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104437983 missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104471425 missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104439408 missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104439351 missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104434714 missense probably benign 0.00
R8780:Hipk3 UTSW 2 104433834 missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104437897 missense probably benign 0.21
X0021:Hipk3 UTSW 2 104441366 critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104434629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACGGAGCTTGCTTGCTTGC -3'
(R):5'- GAATGTCCTCTCACATTGACCCGTG -3'

Sequencing Primer
(F):5'- tgcttgcttgcttgcttg -3'
(R):5'- ACATTGACCCGTGTTTCTTTC -3'
Posted On2013-04-16