Incidental Mutation 'R2424:Arid5a'
ID249462
Institutional Source Beutler Lab
Gene Symbol Arid5a
Ensembl Gene ENSMUSG00000037447
Gene NameAT rich interactive domain 5A (MRF1-like)
SynonymsD430024K22Rik, Mrf1
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2424 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36307733-36324029 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36318501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 136 (Y136H)
Ref Sequence ENSEMBL: ENSMUSP00000115490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097778] [ENSMUST00000115029] [ENSMUST00000115031] [ENSMUST00000115032] [ENSMUST00000116629] [ENSMUST00000126413] [ENSMUST00000137906] [ENSMUST00000142319]
Predicted Effect probably damaging
Transcript: ENSMUST00000097778
AA Change: Y166H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095385
Gene: ENSMUSG00000037447
AA Change: Y166H

DomainStartEndE-ValueType
ARID 76 167 4.69e-34 SMART
BRIGHT 80 172 8.63e-31 SMART
low complexity region 453 467 N/A INTRINSIC
low complexity region 512 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115029
SMART Domains Protein: ENSMUSP00000110681
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
Blast:ARID 1 85 6e-24 BLAST
low complexity region 265 279 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115031
AA Change: Y231H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110683
Gene: ENSMUSG00000037447
AA Change: Y231H

DomainStartEndE-ValueType
ARID 46 232 1.82e-31 SMART
Blast:ARID 281 338 6e-11 BLAST
low complexity region 518 532 N/A INTRINSIC
low complexity region 577 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115032
AA Change: Y137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110684
Gene: ENSMUSG00000037447
AA Change: Y137H

DomainStartEndE-ValueType
ARID 47 138 4.69e-34 SMART
BRIGHT 51 143 8.63e-31 SMART
low complexity region 424 438 N/A INTRINSIC
low complexity region 483 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116629
SMART Domains Protein: ENSMUSP00000136037
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
Blast:ARID 22 55 8e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124280
Predicted Effect probably damaging
Transcript: ENSMUST00000126413
AA Change: Y136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115490
Gene: ENSMUSG00000037447
AA Change: Y136H

DomainStartEndE-ValueType
ARID 46 137 4.69e-34 SMART
BRIGHT 50 142 8.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137906
AA Change: Y79H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117810
Gene: ENSMUSG00000037447
AA Change: Y79H

DomainStartEndE-ValueType
SCOP:d1ig6a_ 41 98 7e-19 SMART
PDB:2OEH|A 42 98 2e-26 PDB
Blast:ARID 42 186 4e-50 BLAST
low complexity region 366 380 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141121
Predicted Effect probably benign
Transcript: ENSMUST00000142319
SMART Domains Protein: ENSMUSP00000119953
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
SCOP:d1kkxa_ 49 81 3e-9 SMART
Blast:ARID 56 121 2e-41 BLAST
PDB:2OEH|A 56 121 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150747
Meta Mutation Damage Score 0.9436 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ARID protein family, including ARID5A, have diverse functions but all appear to play important roles in development, tissue-specific gene expression, and regulation of cell growth (Patsialou et al., 2005 [PubMed 15640446]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced serum interleukin-6 and tumor necrosis factor levels following LPS treatment, and decreased susceptibility to experimental autoimmune encephalomyelitis along with decreased T-helper 17 cell number and increased IFN-gamma producing T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Arid5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Arid5a APN 1 36319433 missense possibly damaging 0.54
IGL02000:Arid5a APN 1 36319497 missense probably damaging 1.00
IGL02322:Arid5a APN 1 36319416 missense probably benign 0.09
PIT4504001:Arid5a UTSW 1 36317625 missense probably damaging 1.00
R0063:Arid5a UTSW 1 36318564 missense probably damaging 1.00
R0063:Arid5a UTSW 1 36318564 missense probably damaging 1.00
R1556:Arid5a UTSW 1 36320164 nonsense probably null
R1703:Arid5a UTSW 1 36319575 unclassified probably null
R4583:Arid5a UTSW 1 36317664 critical splice donor site probably null
R5725:Arid5a UTSW 1 36319130 nonsense probably null
R6056:Arid5a UTSW 1 36319392 missense probably benign 0.01
R7023:Arid5a UTSW 1 36317550 unclassified probably benign
X0020:Arid5a UTSW 1 36319575 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACGAGCTGTGTCCTTGTCAG -3'
(R):5'- AAGCTCCTGGTGTTCCAAG -3'

Sequencing Primer
(F):5'- TCAGGACTGGGATCTGCAG -3'
(R):5'- TCAGAAGCCATGGCCAGAGC -3'
Posted On2014-11-12