Incidental Mutation 'R0308:Plcb1'
ID 24947
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
MMRRC Submission 038518-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R0308 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 134628084-135317178 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 134655534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 38 (V38G)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: V38G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: V38G

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: V38G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: V38G

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130524
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: V38G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: V38G

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202531
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 (GRCm39) D65V probably damaging Het
4933407L21Rik A T 1: 85,859,007 (GRCm39) probably benign Het
Abcc12 C T 8: 87,284,381 (GRCm39) probably benign Het
Adamts12 A G 15: 11,311,646 (GRCm39) E1301G probably damaging Het
Adh4 A T 3: 138,129,863 (GRCm39) N230Y probably damaging Het
Anapc15-ps T A 10: 95,508,954 (GRCm39) M109L probably benign Het
Angpt2 T C 8: 18,742,141 (GRCm39) I472V possibly damaging Het
Arhgef26 C A 3: 62,247,820 (GRCm39) D301E probably benign Het
Armc10 G A 5: 21,852,295 (GRCm39) probably benign Het
Atm T C 9: 53,365,773 (GRCm39) probably null Het
Atp5f1b T C 10: 127,921,908 (GRCm39) V265A probably benign Het
Atp8b1 G T 18: 64,678,315 (GRCm39) C860* probably null Het
Atrnl1 T G 19: 57,741,720 (GRCm39) S1160A probably benign Het
Bmal1 A T 7: 112,890,743 (GRCm39) I179F probably damaging Het
Cep55 A G 19: 38,048,659 (GRCm39) E105G possibly damaging Het
Cfap54 C A 10: 92,721,226 (GRCm39) D2502Y unknown Het
Cilp2 A G 8: 70,335,643 (GRCm39) S452P probably benign Het
Clptm1l A G 13: 73,759,786 (GRCm39) D282G possibly damaging Het
Csrp1 C A 1: 135,673,024 (GRCm39) T47N probably damaging Het
Cyp2c40 T A 19: 39,766,432 (GRCm39) I388F probably damaging Het
Dars1 C T 1: 128,291,996 (GRCm39) R494H probably damaging Het
Dna2 T C 10: 62,792,753 (GRCm39) V256A probably damaging Het
Dock7 T C 4: 98,873,051 (GRCm39) T1132A probably benign Het
Dpcd T G 19: 45,565,445 (GRCm39) F140V probably damaging Het
Elk3 A T 10: 93,101,067 (GRCm39) M228K probably benign Het
Erich6 A G 3: 58,543,525 (GRCm39) F182L probably damaging Het
Fhad1 A G 4: 141,712,904 (GRCm39) probably benign Het
Fryl A T 5: 73,198,947 (GRCm39) probably benign Het
Fzd9 A T 5: 135,278,260 (GRCm39) C542S probably damaging Het
Gba1 A G 3: 89,115,671 (GRCm39) T460A probably benign Het
Gli2 C T 1: 118,769,792 (GRCm39) A587T probably benign Het
Gm11011 C T 2: 169,424,614 (GRCm39) probably benign Het
Gmppb A G 9: 107,927,033 (GRCm39) E68G probably benign Het
Gpld1 A G 13: 25,146,818 (GRCm39) N260S possibly damaging Het
Hipk3 G A 2: 104,263,552 (GRCm39) S900L probably damaging Het
Idi2l T G 13: 8,990,877 (GRCm39) probably benign Het
Ints6l A T X: 55,526,715 (GRCm39) M215L possibly damaging Het
Irx6 T A 8: 93,403,659 (GRCm39) L128Q probably damaging Het
Itga10 T C 3: 96,558,780 (GRCm39) S373P probably damaging Het
Jak1 T C 4: 101,011,732 (GRCm39) probably null Het
Jak2 C T 19: 29,289,157 (GRCm39) T1103I probably benign Het
Katnal1 A T 5: 148,815,734 (GRCm39) V401D possibly damaging Het
Krbox5 A G 13: 67,991,232 (GRCm39) probably benign Het
Lrp2 T A 2: 69,313,326 (GRCm39) probably benign Het
Map3k13 A G 16: 21,710,738 (GRCm39) H7R probably benign Het
Mrgprx3-ps A G 7: 46,959,766 (GRCm39) V75A probably benign Het
Nol6 C T 4: 41,123,584 (GRCm39) A55T probably benign Het
Opa1 G A 16: 29,440,349 (GRCm39) R818Q probably damaging Het
Opn4 T C 14: 34,319,081 (GRCm39) Y168C possibly damaging Het
Or8b35 A G 9: 37,904,141 (GRCm39) I118V probably benign Het
Phf21a T C 2: 92,161,122 (GRCm39) V330A possibly damaging Het
Phykpl A G 11: 51,484,423 (GRCm39) probably benign Het
Plxna4 T A 6: 32,214,703 (GRCm39) T593S probably benign Het
Poll A T 19: 45,544,404 (GRCm39) I339N probably damaging Het
Rev3l A G 10: 39,700,890 (GRCm39) I1796V probably benign Het
Rnf103 G A 6: 71,486,686 (GRCm39) R439H probably damaging Het
Rrn3 G A 16: 13,617,746 (GRCm39) probably benign Het
Sec14l4 G A 11: 3,991,726 (GRCm39) probably benign Het
Sec23a A C 12: 59,053,985 (GRCm39) Y4* probably null Het
Senp6 T C 9: 80,040,265 (GRCm39) probably null Het
Serpinb6b A T 13: 33,162,220 (GRCm39) N221Y probably benign Het
Slc6a2 A G 8: 93,687,988 (GRCm39) E38G possibly damaging Het
Smap1 A T 1: 23,888,423 (GRCm39) L196I probably damaging Het
Sorbs2 C T 8: 46,248,167 (GRCm39) Q473* probably null Het
Sphkap C A 1: 83,254,690 (GRCm39) V1020F probably damaging Het
Srfbp1 T C 18: 52,621,614 (GRCm39) V225A probably benign Het
Srprb G A 9: 103,079,204 (GRCm39) P728S possibly damaging Het
Tarm1 T C 7: 3,545,187 (GRCm39) probably benign Het
Tcp1 T A 17: 13,139,306 (GRCm39) I162N probably benign Het
Tmem237 C A 1: 59,146,676 (GRCm39) A292S probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tnpo1 A G 13: 98,983,011 (GRCm39) F884L probably damaging Het
Trim7 A G 11: 48,740,328 (GRCm39) T142A probably damaging Het
Ttn T A 2: 76,616,024 (GRCm39) I14894F probably damaging Het
Tubgcp6 T C 15: 89,006,639 (GRCm39) R128G possibly damaging Het
Ube2d2b A G 5: 107,978,774 (GRCm39) T142A possibly damaging Het
Unc13c G T 9: 73,388,400 (GRCm39) L2129I probably benign Het
Ushbp1 T C 8: 71,843,697 (GRCm39) D247G probably damaging Het
Usp43 G A 11: 67,770,966 (GRCm39) A556V probably damaging Het
Zfp438 T A 18: 5,213,638 (GRCm39) H440L probably benign Het
Zfp518b C T 5: 38,830,113 (GRCm39) E631K possibly damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,093,676 (GRCm39) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,655,579 (GRCm39) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,062,711 (GRCm39) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,188,238 (GRCm39) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,628,479 (GRCm39) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,229,773 (GRCm39) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,229,091 (GRCm39) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,314,183 (GRCm39) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,136,784 (GRCm39) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,062,779 (GRCm39) splice site probably benign
IGL02926:Plcb1 APN 2 135,206,682 (GRCm39) splice site probably benign
IGL03071:Plcb1 APN 2 135,229,722 (GRCm39) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,188,226 (GRCm39) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,212,348 (GRCm39) missense probably benign
IGL03387:Plcb1 APN 2 134,655,606 (GRCm39) splice site probably benign
BB001:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
BB011:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0415:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,136,831 (GRCm39) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,229,063 (GRCm39) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,167,577 (GRCm39) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,204,364 (GRCm39) splice site probably benign
R1617:Plcb1 UTSW 2 135,179,361 (GRCm39) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R1866:Plcb1 UTSW 2 135,186,093 (GRCm39) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,152,934 (GRCm39) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,655,533 (GRCm39) missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135,228,222 (GRCm39) missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2132:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2133:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2164:Plcb1 UTSW 2 135,188,250 (GRCm39) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,104,020 (GRCm39) splice site probably benign
R2429:Plcb1 UTSW 2 135,179,362 (GRCm39) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,102,428 (GRCm39) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,177,402 (GRCm39) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,167,591 (GRCm39) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,187,010 (GRCm39) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,186,078 (GRCm39) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,093,667 (GRCm39) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,187,015 (GRCm39) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,175,320 (GRCm39) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,104,165 (GRCm39) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,094,696 (GRCm39) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,189,322 (GRCm39) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,102,486 (GRCm39) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,212,513 (GRCm39) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,177,400 (GRCm39) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,104,164 (GRCm39) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,212,486 (GRCm39) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,188,261 (GRCm39) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,177,371 (GRCm39) missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135,167,722 (GRCm39) critical splice donor site probably null
R6683:Plcb1 UTSW 2 134,628,513 (GRCm39) missense probably benign 0.32
R6760:Plcb1 UTSW 2 135,313,980 (GRCm39) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,228,075 (GRCm39) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,104,159 (GRCm39) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,212,430 (GRCm39) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,186,196 (GRCm39) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,093,684 (GRCm39) nonsense probably null
R7498:Plcb1 UTSW 2 135,104,154 (GRCm39) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,104,153 (GRCm39) nonsense probably null
R7777:Plcb1 UTSW 2 135,062,677 (GRCm39) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,188,316 (GRCm39) missense probably benign
R8099:Plcb1 UTSW 2 135,093,654 (GRCm39) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,177,396 (GRCm39) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,159,710 (GRCm39) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,091,972 (GRCm39) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,206,853 (GRCm39) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,094,696 (GRCm39) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,177,369 (GRCm39) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,175,429 (GRCm39) intron probably benign
R8950:Plcb1 UTSW 2 135,179,439 (GRCm39) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,182,615 (GRCm39) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,167,610 (GRCm39) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,189,385 (GRCm39) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,164,558 (GRCm39) missense probably benign 0.03
S24628:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135,186,974 (GRCm39) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,062,766 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTCTGTCAGTTCTGTGTCTGATAACCT -3'
(R):5'- GCCCTTAGCCTGAGTCTCTGGAAGTA -3'

Sequencing Primer
(F):5'- ctgtctattaccatacttgccttc -3'
(R):5'- CCTGAGTCTCTGGAAGTAGAATC -3'
Posted On 2013-04-16