Incidental Mutation 'R2424:Atp10a'
ID249486
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R2424 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58794555 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 560 (H560L)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
Predicted Effect probably benign
Transcript: ENSMUST00000168747
AA Change: H560L

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: H560L

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R7944:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7986:Atp10a UTSW 7 58658822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCATGAGATGTAGACCTG -3'
(R):5'- TCAGCTATCACGATGAAGAGAGTG -3'

Sequencing Primer
(F):5'- TCATGAGATGTAGACCTGTTGAG -3'
(R):5'- AGAGTGTCAAGGGCACTTTG -3'
Posted On2014-11-12