Incidental Mutation 'R2424:Vmn2r72'
ID249488
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2424 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85750953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 296 (V296A)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: V296A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: V296A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 synonymous probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACAATTCTTCAGCGTTTTAC -3'
(R):5'- TGTGTTTGCTATCCTAACTGAGC -3'

Sequencing Primer
(F):5'- CAGCGTTTTACAATTAGATGGTGGC -3'
(R):5'- GCTATCCTAACTGAGCATAGCATGG -3'
Posted On2014-11-12