Incidental Mutation 'R2424:Mapk9'
ID249500
Institutional Source Beutler Lab
Gene Symbol Mapk9
Ensembl Gene ENSMUSG00000020366
Gene Namemitogen-activated protein kinase 9
SynonymsJNK2, JNK/SAPK alpha, Prkm9
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R2424 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49846751-49886421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49863672 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 84 (N84S)
Ref Sequence ENSEMBL: ENSMUSP00000136977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]
Predicted Effect probably damaging
Transcript: ENSMUST00000020634
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043321
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102778
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109178
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109179
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151695
Predicted Effect probably damaging
Transcript: ENSMUST00000164643
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178543
AA Change: N84S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366
AA Change: N84S

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Meta Mutation Damage Score 0.8197 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Mapk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Mapk9 APN 11 49867038 missense probably damaging 1.00
IGL03399:Mapk9 APN 11 49883299 utr 3 prime probably benign
Infirm UTSW 11 49863556 missense probably damaging 1.00
R0003:Mapk9 UTSW 11 49867039 missense possibly damaging 0.52
R0610:Mapk9 UTSW 11 49863573 missense probably benign 0.00
R0676:Mapk9 UTSW 11 49883156 makesense probably null
R0681:Mapk9 UTSW 11 49869245 missense probably damaging 1.00
R0736:Mapk9 UTSW 11 49883254 missense possibly damaging 0.58
R1186:Mapk9 UTSW 11 49878269 missense probably damaging 0.99
R1964:Mapk9 UTSW 11 49854333 missense probably null 1.00
R4876:Mapk9 UTSW 11 49854325 missense probably damaging 0.97
R6191:Mapk9 UTSW 11 49863556 missense probably damaging 1.00
R7059:Mapk9 UTSW 11 49867047 splice site probably null
R7484:Mapk9 UTSW 11 49872836 missense probably damaging 0.97
RF010:Mapk9 UTSW 11 49854256 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAAACATTTCTCCTTGCC -3'
(R):5'- AGGGTTGGTATCAAGATTAGGCTC -3'

Sequencing Primer
(F):5'- GCCTTGTTATTCTCTTTGAAAGACAG -3'
(R):5'- ATCTTCGGTCTGGTCACA -3'
Posted On2014-11-12