Mutagenetix > Incidental Mutations

Incidental Mutation 'R2424:Obscn'

249501

Institutional Source

Beutler Lab

Gene Symbol

Obscn

Ensembl Gene

ENSMUSG00000061462

Gene Name

obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Synonyms

OTTMUSG00000005786, LOC380698

MMRRC Submission

040386-MU

Accession Numbers

Genbank: NM_001171512.1, NM_199152.2; MGI: 2681862

Is this an essential gene?

Probably essential (E-score: 0.795) question?

Stock #

R2424 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

58994256-59136402 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 58994451 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104438 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047441] [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]

Predicted Effect

unknown
Transcript: ENSMUST00000047441
AA Change: T7994A

SMART Domains

Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: T7994A

Domain	Start	End	E-Value	Type
IGc2	21	88	8e-12	SMART
IGc2	121	190	8.31e-10	SMART
low complexity region	191	207	N/A	INTRINSIC
IGc2	248	316	4.63e-8	SMART
IG	337	417	5.32e-8	SMART
IG_like	425	506	1.5e2	SMART
FN3	510	596	2.11e-9	SMART
IG	711	790	2.39e-1	SMART
IGc2	876	942	2.54e-5	SMART
IGc2	968	1034	2.54e-5	SMART
IGc2	1060	1126	4.49e-6	SMART
IGc2	1152	1218	7.82e-6	SMART
IGc2	1244	1310	5.16e-6	SMART
IGc2	1336	1402	1.93e-5	SMART
IGc2	1428	1494	1.93e-5	SMART
IGc2	1520	1586	1.93e-5	SMART
IGc2	1612	1678	1.93e-5	SMART
IGc2	1704	1770	1.93e-5	SMART
IGc2	1796	1862	7.94e-7	SMART
IG	1882	1962	5.37e-4	SMART
IG	1972	2051	9.93e-8	SMART
IG	2062	2141	2.48e-8	SMART
IG	2151	2230	3.89e-1	SMART
IG	2240	2319	1.92e0	SMART
IG	2329	2407	6.45e-7	SMART
IG	2452	2531	1.22e-7	SMART
IGc2	2637	2703	9.93e-8	SMART
low complexity region	2705	2716	N/A	INTRINSIC
IG	2720	2799	2.44e0	SMART
IGc2	2815	2881	2.1e-6	SMART
IG	2898	2979	2.86e0	SMART
IGc2	2995	3061	8.38e-6	SMART
IG	3078	3157	1.2e-6	SMART
IG	3167	3248	1.42e-3	SMART
IGc2	3264	3330	3.85e-5	SMART
IGc2	3353	3419	3.13e-5	SMART
IGc2	3442	3507	3.3e-4	SMART
IGc2	3530	3595	5.84e-5	SMART
IGc2	3618	3683	1.29e-6	SMART
IG_like	3706	3771	3.16e-1	SMART
IGc2	3779	3844	1.46e-5	SMART
IGc2	3867	3932	1.56e-5	SMART
IGc2	3955	4020	1.19e-5	SMART
IGc2	4043	4108	1.93e-5	SMART
IG	4125	4203	1.85e-7	SMART
IGc2	4219	4285	5.08e-5	SMART
IGc2	4308	4374	1.11e-5	SMART
IGc2	4397	4465	6.71e-5	SMART
IG	4482	4564	2.06e-5	SMART
IG	4574	4655	5.01e-4	SMART
IG	4664	4746	1.04e-1	SMART
FN3	4749	4831	2.44e-14	SMART
IG	4858	4940	3.68e-2	SMART
IQ	5100	5122	3.65e-4	SMART
IGc2	5139	5207	8.72e-4	SMART
low complexity region	5215	5231	N/A	INTRINSIC
low complexity region	5232	5248	N/A	INTRINSIC
low complexity region	5251	5274	N/A	INTRINSIC
IGc2	5369	5437	3.25e-12	SMART
low complexity region	5450	5466	N/A	INTRINSIC
IG	5496	5580	1.55e0	SMART
IGc2	5612	5685	1.82e-6	SMART
low complexity region	5799	5829	N/A	INTRINSIC
SH3	5832	5895	1.22e0	SMART
Pfam:RhoGEF	5926	6104	4.5e-21	PFAM
PH	6125	6235	2.74e-11	SMART
IGc2	6255	6323	3.73e-12	SMART
IGc2	6349	6418	1.18e-14	SMART
IGc2	6464	6531	1.7e-6	SMART
S_TKc	6562	6815	1.66e-79	SMART
Blast:STYKc	6843	6935	5e-39	BLAST
low complexity region	6939	6954	N/A	INTRINSIC
low complexity region	7013	7029	N/A	INTRINSIC
low complexity region	7146	7161	N/A	INTRINSIC
low complexity region	7199	7219	N/A	INTRINSIC
low complexity region	7499	7514	N/A	INTRINSIC
IGc2	7538	7606	6.3e-10	SMART
FN3	7620	7698	9.33e-2	SMART
STYKc	7736	7988	8.55e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093061

SMART Domains

Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455

Domain	Start	End	E-Value	Type
RING	16	56	3.05e-9	SMART
BBOX	87	127	5.81e-6	SMART
coiled coil region	137	207	N/A	INTRINSIC
PRY	285	337	4.1e-24	SMART
SPRY	338	457	2.58e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108809

SMART Domains

Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455

Domain	Start	End	E-Value	Type
RING	16	56	3.05e-9	SMART
BBOX	87	127	5.81e-6	SMART
coiled coil region	137	207	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108810

SMART Domains

Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455

Domain	Start	End	E-Value	Type
RING	16	56	3.05e-9	SMART
BBOX	87	127	5.81e-6	SMART
coiled coil region	137	207	N/A	INTRINSIC
PRY	301	353	4.1e-24	SMART
SPRY	354	473	2.58e-22	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000138587
AA Change: T2514A

SMART Domains

Protein: ENSMUSP00000121092
Gene: ENSMUSG00000061462
AA Change: T2514A

Domain	Start	End	E-Value	Type
IG	2	83	1.28e-1	SMART
low complexity region	186	216	N/A	INTRINSIC
SH3	219	282	1.22e0	SMART
Pfam:RhoGEF	313	491	6.1e-22	PFAM
PH	512	622	2.74e-11	SMART
IGc2	642	710	3.73e-12	SMART
IGc2	736	805	1.18e-14	SMART
low complexity region	843	857	N/A	INTRINSIC
IGc2	985	1052	1.7e-6	SMART
S_TKc	1083	1336	1.66e-79	SMART
Blast:STYKc	1364	1456	1e-38	BLAST
low complexity region	1460	1475	N/A	INTRINSIC
low complexity region	1534	1550	N/A	INTRINSIC
low complexity region	1667	1682	N/A	INTRINSIC
low complexity region	1720	1740	N/A	INTRINSIC
low complexity region	2020	2035	N/A	INTRINSIC
IGc2	2059	2127	6.3e-10	SMART
FN3	2141	2219	9.33e-2	SMART
STYKc	2257	2509	8.55e-41	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,756	T691A	probably benign	Het
Aacs	A	G	5: 125,513,095		probably null	Het
Acot3	G	T	12: 84,053,864	R138L	probably damaging	Het
Ago3	A	G	4: 126,404,247	V160A	probably damaging	Het
Akap9	A	C	5: 4,065,279	E166D	probably damaging	Het
Arid5a	T	C	1: 36,318,501	Y136H	probably damaging	Het
Ascc3	T	C	10: 50,618,201	V244A	probably benign	Het
Atp10a	A	T	7: 58,794,555	H560L	probably benign	Het
Btbd6	A	G	12: 112,978,360	T482A	probably benign	Het
Cacna1d	A	T	14: 30,049,023	Y1828N	probably damaging	Het
Capzb	A	G	4: 139,194,130	M1V	probably null	Het
Cdh9	T	G	15: 16,850,354	F524L	probably damaging	Het
Ctnna1	T	C	18: 35,253,707	S846P	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dock7	T	A	4: 98,945,307	R1886*	probably null	Het
Dpp3	A	T	19: 4,907,707	L711*	probably null	Het
Dst	T	A	1: 34,167,060	I566N	probably damaging	Het
Eif2b3	T	A	4: 117,070,848	S421R	probably benign	Het
Epg5	T	C	18: 77,968,613	V825A	probably benign	Het
Eya1	T	A	1: 14,270,848		probably benign	Het
Fam187a	T	C	11: 102,885,954	Y195H	probably damaging	Het
Fbn2	C	T	18: 58,203,787	C132Y	probably damaging	Het
Fbxw21	A	T	9: 109,157,519	Y97*	probably null	Het
Grin1	A	T	2: 25,318,652	C79S	probably null	Het
Haao	T	A	17: 83,835,562	Y118F	probably damaging	Het
Il11ra1	T	A	4: 41,768,222	S378T	probably damaging	Het
Kcnj5	A	T	9: 32,322,820	N66K	probably damaging	Het
Kif21a	T	A	15: 90,971,196	N668I	probably damaging	Het
Kprp	A	T	3: 92,825,605	L46Q	probably damaging	Het
Lama1	C	T	17: 67,798,665	T2056I	probably benign	Het
Madd	G	C	2: 91,166,622	D824E	probably damaging	Het
Mapk9	A	G	11: 49,863,672	N84S	probably damaging	Het
Mrpl39	A	G	16: 84,730,860	V160A	probably benign	Het
Mrpl9	T	C	3: 94,443,806	S98P	probably benign	Het
Mybpc3	A	T	2: 91,135,793	M1233L	probably benign	Het
Neb	A	G	2: 52,209,659		probably benign	Het
Ngly1	A	G	14: 16,290,721		probably null	Het
Nt5c1b	A	T	12: 10,370,072	T4S	probably damaging	Het
Olfr725	T	C	14: 50,034,824	Y193C	probably damaging	Het
Olfr904	T	C	9: 38,464,832	S264P	probably damaging	Het
Olfr92	T	C	17: 37,111,516	I155M	probably benign	Het
Olfr968	A	G	9: 39,772,297	F168L	probably benign	Het
Otog	A	T	7: 46,298,169	K64*	probably null	Het
Papola	A	G	12: 105,827,052	T544A	probably benign	Het
Phc1	A	G	6: 122,320,043	V790A	probably damaging	Het
Phf3	G	T	1: 30,806,349	R1252S	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rgs17	T	A	10: 5,833,111	I159F	probably damaging	Het
Rgs17	T	A	10: 5,842,560	E62V	probably benign	Het
Rnase1	A	G	14: 51,145,547	Y117H	possibly damaging	Het
Rnf214	T	C	9: 45,899,798	D189G	probably damaging	Het
Sema4b	A	G	7: 80,219,275	N365S	probably damaging	Het
Setd2	A	G	9: 110,617,522	H2480R	probably benign	Het
Slc27a6	G	T	18: 58,605,117	C415F	probably benign	Het
Stim1	A	G	7: 102,408,405	I142V	probably benign	Het
Supt5	T	C	7: 28,315,165	I1070V	possibly damaging	Het
Tbp	T	C	17: 15,513,533	F174L	possibly damaging	Het
Tex26	A	G	5: 149,470,448		probably benign	Het
Tmem132d	A	G	5: 127,864,599	V479A	probably benign	Het
Ttn	T	C	2: 76,881,145		probably benign	Het
Urb2	T	A	8: 124,030,426	N957K	probably benign	Het
Usp24	T	C	4: 106,399,113		probably null	Het
Vmn2r114	T	C	17: 23,296,868	T550A	possibly damaging	Het
Vmn2r72	A	G	7: 85,750,953	V296A	probably damaging	Het
Vmn2r91	C	A	17: 18,136,169	Y699*	probably null	Het

Other mutations in Obscn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Obscn	APN	11	59002057	missense	probably benign	0.01
IGL00417:Obscn	APN	11	59006788	missense	unknown
IGL01018:Obscn	APN	11	59128069	missense	probably damaging	0.99
IGL01083:Obscn	APN	11	59036093	missense	probably damaging	0.99
IGL01109:Obscn	APN	11	59133762	missense	probably damaging	1.00
IGL01139:Obscn	APN	11	59078352	missense	probably damaging	1.00
IGL01361:Obscn	APN	11	59028889	missense	probably damaging	0.99
IGL01370:Obscn	APN	11	58995563	critical splice acceptor site	probably null
IGL01409:Obscn	APN	11	59031058	missense	probably damaging	1.00
IGL01432:Obscn	APN	11	59033757	missense	probably benign	0.27
IGL01527:Obscn	APN	11	59064417	missense	possibly damaging	0.83
IGL01543:Obscn	APN	11	59042117	missense	probably benign	0.01
IGL01578:Obscn	APN	11	58999680	missense	unknown
IGL01603:Obscn	APN	11	59037805	missense	probably damaging	1.00
IGL01750:Obscn	APN	11	59031639	missense	probably damaging	1.00
IGL01765:Obscn	APN	11	59115784	missense	possibly damaging	0.58
IGL01805:Obscn	APN	11	59132596	missense	probably damaging	0.99
IGL01816:Obscn	APN	11	58995779	splice site	probably benign
IGL01885:Obscn	APN	11	59074968	missense	possibly damaging	0.60
IGL01911:Obscn	APN	11	59008595	nonsense	probably null
IGL01963:Obscn	APN	11	59020541	missense	probably benign	0.16
IGL02012:Obscn	APN	11	59076507	missense	probably benign	0.03
IGL02096:Obscn	APN	11	59080704	missense	probably damaging	0.98
IGL02125:Obscn	APN	11	59093326	missense	possibly damaging	0.95
IGL02125:Obscn	APN	11	59022362	missense	probably damaging	1.00
IGL02203:Obscn	APN	11	59082308	missense	probably damaging	1.00
IGL02232:Obscn	APN	11	59038978	missense	probably damaging	0.97
IGL02262:Obscn	APN	11	59028533	missense	possibly damaging	0.88
IGL02304:Obscn	APN	11	59076622	missense	probably damaging	1.00
IGL02306:Obscn	APN	11	58999671	missense	unknown
IGL02323:Obscn	APN	11	59008522	missense	possibly damaging	0.51
IGL02341:Obscn	APN	11	59135825	missense	probably benign	0.09
IGL02342:Obscn	APN	11	59001088	missense	probably benign	0.00
IGL02352:Obscn	APN	11	59001027	missense	probably benign	0.10
IGL02397:Obscn	APN	11	59076899	missense	possibly damaging	0.67
IGL02405:Obscn	APN	11	59132602	missense	probably damaging	0.96
IGL02427:Obscn	APN	11	59067162	missense	probably damaging	1.00
IGL02479:Obscn	APN	11	59056227	splice site	probably benign
IGL02512:Obscn	APN	11	59028517	missense	probably damaging	1.00
IGL02566:Obscn	APN	11	59068147	missense	probably damaging	1.00
IGL02613:Obscn	APN	11	59002132	missense	probably benign	0.03
IGL02634:Obscn	APN	11	59054785	missense	probably damaging	1.00
IGL02680:Obscn	APN	11	59000020	missense	unknown
IGL02715:Obscn	APN	11	59080311	missense	probably benign	0.25
IGL02718:Obscn	APN	11	59077858	missense	probably damaging	1.00
IGL02723:Obscn	APN	11	59124620	missense	probably benign	0.17
IGL02735:Obscn	APN	11	59093349	missense	probably damaging	1.00
IGL02951:Obscn	APN	11	58994513	splice site	probably benign
IGL03004:Obscn	APN	11	59028587	missense	probably damaging	1.00
IGL03078:Obscn	APN	11	59078798	splice site	probably null
IGL03114:Obscn	APN	11	59000539	missense	unknown
IGL03125:Obscn	APN	11	59061648	missense	probably damaging	1.00
IGL03150:Obscn	APN	11	59051723	missense	probably damaging	1.00
IGL03156:Obscn	APN	11	59054896	missense	probably damaging	1.00
IGL03169:Obscn	APN	11	59073296	missense	probably damaging	1.00
IGL03297:Obscn	APN	11	59060886	missense	possibly damaging	0.83
IGL03326:Obscn	APN	11	59032902	missense	probably damaging	1.00
IGL03345:Obscn	APN	11	58995482	unclassified	probably benign
IGL03348:Obscn	APN	11	59050362	missense	probably damaging	1.00
IGL03355:Obscn	APN	11	59037792	missense	probably damaging	1.00
IGL03377:Obscn	APN	11	58999873	missense	probably damaging	1.00
IGL03396:Obscn	APN	11	59073578	missense	probably benign	0.12
IGL03405:Obscn	APN	11	59000124	missense	unknown
Bull	UTSW	11	59032918	missense	possibly damaging	0.85
ducking	UTSW	11	59080969	unclassified	probably benign
Goose	UTSW	11	59050480	missense	probably benign	0.23
Obscurity	UTSW	11	58994700	nonsense	probably null
Tallow	UTSW	11	59076993	missense	possibly damaging	0.95
BB001:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB002:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB011:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB012:Obscn	UTSW	11	59112555	missense	probably benign	0.27
IGL02802:Obscn	UTSW	11	59000484	missense	unknown
N/A - 535:Obscn	UTSW	11	59000308	missense	possibly damaging	0.67
PIT4131001:Obscn	UTSW	11	59067064	critical splice donor site	probably null
PIT4453001:Obscn	UTSW	11	59060976	missense	probably damaging	1.00
PIT4453001:Obscn	UTSW	11	59069834	missense	possibly damaging	0.76
PIT4504001:Obscn	UTSW	11	59133122	missense	probably damaging	1.00
PIT4651001:Obscn	UTSW	11	59041681	missense	probably damaging	0.99
R0033:Obscn	UTSW	11	58994746	unclassified	probably benign
R0041:Obscn	UTSW	11	59043977	missense	probably damaging	1.00
R0042:Obscn	UTSW	11	59052585	missense	probably damaging	1.00
R0064:Obscn	UTSW	11	59027466	missense	probably damaging	1.00
R0064:Obscn	UTSW	11	59027466	missense	probably damaging	1.00
R0071:Obscn	UTSW	11	59064201	missense	possibly damaging	0.85
R0077:Obscn	UTSW	11	59051521	splice site	probably benign
R0083:Obscn	UTSW	11	59022374	missense	probably damaging	1.00
R0089:Obscn	UTSW	11	59000062	missense	unknown
R0092:Obscn	UTSW	11	59051247	missense	possibly damaging	0.96
R0103:Obscn	UTSW	11	59062696	nonsense	probably null
R0103:Obscn	UTSW	11	59062696	nonsense	probably null
R0108:Obscn	UTSW	11	59022374	missense	probably damaging	1.00
R0152:Obscn	UTSW	11	59052576	missense	probably benign	0.06
R0268:Obscn	UTSW	11	59067272	missense	possibly damaging	0.78
R0271:Obscn	UTSW	11	59056742	intron	probably benign
R0281:Obscn	UTSW	11	59038615	missense	probably damaging	1.00
R0329:Obscn	UTSW	11	59040441	missense	probably damaging	1.00
R0329:Obscn	UTSW	11	59052506	missense	probably damaging	1.00
R0360:Obscn	UTSW	11	59128281	missense	probably benign	0.22
R0364:Obscn	UTSW	11	59128281	missense	probably benign	0.22
R0382:Obscn	UTSW	11	59040306	missense	probably damaging	1.00
R0386:Obscn	UTSW	11	59136339	missense	probably damaging	1.00
R0403:Obscn	UTSW	11	59076540	missense	probably damaging	1.00
R0413:Obscn	UTSW	11	59002997	missense	probably benign	0.03
R0437:Obscn	UTSW	11	58995088	unclassified	probably benign
R0442:Obscn	UTSW	11	59002174	splice site	probably benign
R0445:Obscn	UTSW	11	58999335	missense	unknown
R0446:Obscn	UTSW	11	58995412	unclassified	probably benign
R0454:Obscn	UTSW	11	58999623	missense	unknown
R0463:Obscn	UTSW	11	59061530	missense	probably benign	0.07
R0479:Obscn	UTSW	11	59112707	missense	probably damaging	1.00
R0480:Obscn	UTSW	11	59133946	nonsense	probably null
R0504:Obscn	UTSW	11	59008507	critical splice donor site	probably null
R0507:Obscn	UTSW	11	59029341	missense	probably damaging	1.00
R0513:Obscn	UTSW	11	59061522	missense	possibly damaging	0.81
R0541:Obscn	UTSW	11	59081984	missense	probably damaging	1.00
R0551:Obscn	UTSW	11	59107862	nonsense	probably null
R0573:Obscn	UTSW	11	59036079	missense	probably damaging	1.00
R0599:Obscn	UTSW	11	59073696	missense	probably damaging	1.00
R0637:Obscn	UTSW	11	59051644	missense	probably damaging	1.00
R0637:Obscn	UTSW	11	59082776	missense	probably damaging	0.96
R0653:Obscn	UTSW	11	59007708	unclassified	probably benign
R0712:Obscn	UTSW	11	59049445	missense	possibly damaging	0.72
R0715:Obscn	UTSW	11	59050480	missense	probably benign	0.23
R0729:Obscn	UTSW	11	59032709	missense	probably damaging	1.00
R0741:Obscn	UTSW	11	59063453	frame shift	probably null
R0745:Obscn	UTSW	11	59082239	missense	probably benign	0.14
R0751:Obscn	UTSW	11	59081819	missense	probably damaging	1.00
R0834:Obscn	UTSW	11	59133278	missense	probably benign	0.25
R0863:Obscn	UTSW	11	58995415	unclassified	probably benign
R0909:Obscn	UTSW	11	59075064	missense	probably damaging	1.00
R0965:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R0969:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R0980:Obscn	UTSW	11	58998061	missense	possibly damaging	0.92
R1017:Obscn	UTSW	11	58998353	missense	unknown
R1103:Obscn	UTSW	11	59021483	missense	probably damaging	1.00
R1107:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R1128:Obscn	UTSW	11	59028943	missense	probably null	0.71
R1164:Obscn	UTSW	11	59036087	missense	possibly damaging	0.65
R1192:Obscn	UTSW	11	59067199	missense	probably benign	0.33
R1298:Obscn	UTSW	11	59054897	missense	possibly damaging	0.65
R1331:Obscn	UTSW	11	59086928	missense	probably benign	0.09
R1333:Obscn	UTSW	11	59080317	missense	probably damaging	0.99
R1341:Obscn	UTSW	11	59029372	splice site	probably benign
R1385:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R1386:Obscn	UTSW	11	59133853	missense	probably damaging	1.00
R1390:Obscn	UTSW	11	59093448	missense	probably damaging	1.00
R1460:Obscn	UTSW	11	59055966	missense	probably damaging	1.00
R1495:Obscn	UTSW	11	59080160	missense	probably damaging	0.99
R1496:Obscn	UTSW	11	59031036	missense	probably benign	0.01
R1524:Obscn	UTSW	11	59115855	missense	probably damaging	1.00
R1526:Obscn	UTSW	11	59028586	missense	probably damaging	1.00
R1537:Obscn	UTSW	11	59000749	missense	unknown
R1554:Obscn	UTSW	11	59003648	missense	unknown
R1561:Obscn	UTSW	11	59036073	missense	probably damaging	1.00
R1589:Obscn	UTSW	11	59036075	missense	possibly damaging	0.89
R1615:Obscn	UTSW	11	59099825	missense	probably benign	0.09
R1627:Obscn	UTSW	11	59112638	missense	probably benign	0.14
R1634:Obscn	UTSW	11	59076896	missense	probably damaging	1.00
R1636:Obscn	UTSW	11	59122637	missense	probably damaging	1.00
R1681:Obscn	UTSW	11	59103325	missense	probably damaging	1.00
R1686:Obscn	UTSW	11	59106287	splice site	probably benign
R1713:Obscn	UTSW	11	59079886	missense	probably damaging	1.00
R1730:Obscn	UTSW	11	59073633	missense	probably damaging	1.00
R1781:Obscn	UTSW	11	59106337	missense	probably damaging	1.00
R1783:Obscn	UTSW	11	59073633	missense	probably damaging	1.00
R1793:Obscn	UTSW	11	59077780	missense	probably damaging	1.00
R1796:Obscn	UTSW	11	59029337	missense	possibly damaging	0.94
R1801:Obscn	UTSW	11	58998321	missense	unknown
R1824:Obscn	UTSW	11	58994832	unclassified	probably benign
R1856:Obscn	UTSW	11	59040296	missense	probably damaging	1.00
R1866:Obscn	UTSW	11	59060915	missense	probably benign	0.34
R1878:Obscn	UTSW	11	58995553	missense	probably damaging	0.99
R1883:Obscn	UTSW	11	59078203	missense	probably damaging	1.00
R1926:Obscn	UTSW	11	59063474	missense	possibly damaging	0.69
R1967:Obscn	UTSW	11	59135709	nonsense	probably null
R1975:Obscn	UTSW	11	59067729	missense	probably damaging	1.00
R1992:Obscn	UTSW	11	58995827	unclassified	probably benign
R2021:Obscn	UTSW	11	59067174	missense	probably benign	0.40
R2066:Obscn	UTSW	11	59135732	missense	possibly damaging	0.59
R2074:Obscn	UTSW	11	59069281	missense	probably damaging	0.99
R2074:Obscn	UTSW	11	59132652	missense	probably damaging	1.00
R2081:Obscn	UTSW	11	59034182	missense	possibly damaging	0.90
R2083:Obscn	UTSW	11	59073631	nonsense	probably null
R2086:Obscn	UTSW	11	59078256	missense	probably damaging	0.99
R2095:Obscn	UTSW	11	59093584	splice site	probably null
R2098:Obscn	UTSW	11	59069991	missense	probably damaging	1.00
R2114:Obscn	UTSW	11	59131658	missense	probably damaging	0.99
R2138:Obscn	UTSW	11	59003665	nonsense	probably null
R2193:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2194:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2210:Obscn	UTSW	11	59068087	missense	probably damaging	1.00
R2233:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2234:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2287:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2288:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2351:Obscn	UTSW	11	59112612	missense	probably damaging	0.99
R2376:Obscn	UTSW	11	59069124	missense	probably damaging	1.00
R2384:Obscn	UTSW	11	59042837	critical splice donor site	probably null
R2401:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2402:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2403:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2433:Obscn	UTSW	11	59039086	splice site	probably null
R2445:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2446:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2447:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2449:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2483:Obscn	UTSW	11	59080146	missense	probably damaging	1.00
R2484:Obscn	UTSW	11	59007540	unclassified	probably benign
R2496:Obscn	UTSW	11	59103442	missense	probably damaging	1.00
R2510:Obscn	UTSW	11	59042314	splice site	probably benign
R2851:Obscn	UTSW	11	59030018	critical splice donor site	probably null
R2878:Obscn	UTSW	11	59056188	missense	possibly damaging	0.94
R2879:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2885:Obscn	UTSW	11	59086748	missense	probably damaging	1.00
R2885:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2886:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2985:Obscn	UTSW	11	59133089	missense	probably damaging	1.00
R3013:Obscn	UTSW	11	59060918	missense	probably damaging	1.00
R3118:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3236:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3237:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3432:Obscn	UTSW	11	59031177	missense	probably damaging	1.00
R3694:Obscn	UTSW	11	59078395	missense	probably damaging	1.00
R3716:Obscn	UTSW	11	59082661	missense	probably damaging	1.00
R3717:Obscn	UTSW	11	59082661	missense	probably damaging	1.00
R3743:Obscn	UTSW	11	59079085	missense	probably damaging	0.99
R3760:Obscn	UTSW	11	59028580	missense	probably damaging	1.00
R3795:Obscn	UTSW	11	59031841	missense	probably damaging	1.00
R3857:Obscn	UTSW	11	59080969	unclassified	probably benign
R3858:Obscn	UTSW	11	59080969	unclassified	probably benign
R3862:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3863:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3864:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3881:Obscn	UTSW	11	59056949	missense	probably damaging	1.00
R3890:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3903:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3923:Obscn	UTSW	11	59060928	missense	possibly damaging	0.96
R3944:Obscn	UTSW	11	59132547	missense	probably damaging	1.00
R3947:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3948:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3955:Obscn	UTSW	11	59036768	missense	probably damaging	1.00
R3970:Obscn	UTSW	11	59051662	missense	probably damaging	1.00
R3971:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4001:Obscn	UTSW	11	59134569	missense	probably damaging	1.00
R4005:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4017:Obscn	UTSW	11	59132622	missense	probably damaging	1.00
R4028:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4029:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4041:Obscn	UTSW	11	59051531	nonsense	probably null
R4061:Obscn	UTSW	11	59008532	missense	probably damaging	1.00
R4062:Obscn	UTSW	11	59082710	missense	probably damaging	0.99
R4072:Obscn	UTSW	11	58997183	missense	unknown
R4078:Obscn	UTSW	11	59038363	missense	probably benign	0.41
R4079:Obscn	UTSW	11	59038363	missense	probably benign	0.41
R4092:Obscn	UTSW	11	59056060	missense	probably benign	0.12
R4106:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4108:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4403:Obscn	UTSW	11	59069093	missense	possibly damaging	0.95
R4477:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4478:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4480:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4489:Obscn	UTSW	11	59031591	missense	possibly damaging	0.74
R4531:Obscn	UTSW	11	59007874	unclassified	probably benign
R4551:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4552:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4553:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4558:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4570:Obscn	UTSW	11	59006828	splice site	probably null
R4575:Obscn	UTSW	11	59122772	missense	probably damaging	0.99
R4593:Obscn	UTSW	11	59133249	missense	probably damaging	1.00
R4604:Obscn	UTSW	11	59080205	missense	probably damaging	1.00
R4604:Obscn	UTSW	11	59122746	missense	probably damaging	0.96
R4625:Obscn	UTSW	11	59067258	missense	probably damaging	1.00
R4646:Obscn	UTSW	11	59124570	nonsense	probably null
R4651:Obscn	UTSW	11	59038877	missense	probably damaging	1.00
R4652:Obscn	UTSW	11	59038877	missense	probably damaging	1.00
R4657:Obscn	UTSW	11	59042290	missense	probably damaging	1.00
R4658:Obscn	UTSW	11	59054288	nonsense	probably null
R4662:Obscn	UTSW	11	58999596	missense	unknown
R4665:Obscn	UTSW	11	59124752	missense	probably damaging	1.00
R4718:Obscn	UTSW	11	59021954	missense	probably damaging	1.00
R4736:Obscn	UTSW	11	59063536	missense	probably damaging	1.00
R4746:Obscn	UTSW	11	59079808	critical splice donor site	probably null
R4754:Obscn	UTSW	11	59036043	missense	possibly damaging	0.81
R4758:Obscn	UTSW	11	59003363	missense	unknown
R4758:Obscn	UTSW	11	59135917	missense	probably damaging	0.98
R4766:Obscn	UTSW	11	59012742	missense	probably damaging	1.00
R4798:Obscn	UTSW	11	59069859	missense	probably damaging	0.99
R4810:Obscn	UTSW	11	59031591	missense	possibly damaging	0.74
R4819:Obscn	UTSW	11	59038848	missense	probably damaging	0.97
R4821:Obscn	UTSW	11	59006826	splice site	probably benign
R4821:Obscn	UTSW	11	59040467	missense	probably damaging	1.00
R4822:Obscn	UTSW	11	59022333	missense	probably benign	0.11
R4828:Obscn	UTSW	11	59086670	missense	possibly damaging	0.93
R4829:Obscn	UTSW	11	59054246	missense	probably null	0.53
R4830:Obscn	UTSW	11	59067607	missense	probably damaging	1.00
R4859:Obscn	UTSW	11	59082023	missense	possibly damaging	0.89
R4870:Obscn	UTSW	11	59136206	missense	probably damaging	1.00
R4909:Obscn	UTSW	11	59061465	missense	possibly damaging	0.52
R4955:Obscn	UTSW	11	59069172	missense	probably benign	0.31
R4973:Obscn	UTSW	11	59132466	missense	probably damaging	1.00
R4993:Obscn	UTSW	11	59124761	missense	possibly damaging	0.48
R5034:Obscn	UTSW	11	59061676	nonsense	probably null
R5054:Obscn	UTSW	11	59073617	missense	probably damaging	1.00
R5077:Obscn	UTSW	11	59044057	missense	probably damaging	0.98
R5126:Obscn	UTSW	11	59077063	missense	probably damaging	1.00
R5135:Obscn	UTSW	11	59129653	missense	probably damaging	1.00
R5161:Obscn	UTSW	11	59028604	missense	probably damaging	1.00
R5161:Obscn	UTSW	11	59064310	missense	possibly damaging	0.60
R5195:Obscn	UTSW	11	59060850	missense	possibly damaging	0.78
R5222:Obscn	UTSW	11	59044145	missense	possibly damaging	0.80
R5260:Obscn	UTSW	11	59003369	missense	probably damaging	1.00
R5301:Obscn	UTSW	11	59135408	missense	probably damaging	1.00
R5305:Obscn	UTSW	11	59012715	missense	possibly damaging	0.83
R5323:Obscn	UTSW	11	58996877	missense	probably benign
R5333:Obscn	UTSW	11	59062692	missense	probably damaging	1.00
R5366:Obscn	UTSW	11	59080260	missense	probably damaging	1.00
R5368:Obscn	UTSW	11	59069026	critical splice donor site	probably null
R5408:Obscn	UTSW	11	59051611	missense	probably damaging	1.00
R5439:Obscn	UTSW	11	59000128	nonsense	probably null
R5536:Obscn	UTSW	11	59107871	missense	probably damaging	1.00
R5561:Obscn	UTSW	11	59036093	missense	probably damaging	0.99
R5573:Obscn	UTSW	11	59034705	missense	possibly damaging	0.94
R5582:Obscn	UTSW	11	59099976	splice site	probably null
R5586:Obscn	UTSW	11	59001468	nonsense	probably null
R5607:Obscn	UTSW	11	59122848	missense	probably benign	0.22
R5700:Obscn	UTSW	11	59133194	missense	probably benign	0.37
R5706:Obscn	UTSW	11	59076256	missense	probably damaging	1.00
R5718:Obscn	UTSW	11	59036808	missense	probably damaging	1.00
R5771:Obscn	UTSW	11	59000707	missense	unknown
R5772:Obscn	UTSW	11	59056144	missense	probably damaging	0.99
R5786:Obscn	UTSW	11	59032691	missense	probably damaging	1.00
R5807:Obscn	UTSW	11	59079650	missense	probably damaging	1.00
R5815:Obscn	UTSW	11	59082189	splice site	probably null
R5835:Obscn	UTSW	11	59002081	missense	probably benign	0.03
R5835:Obscn	UTSW	11	59042127	missense	probably damaging	1.00
R5846:Obscn	UTSW	11	59038609	missense	probably damaging	1.00
R5851:Obscn	UTSW	11	58994700	nonsense	probably null
R5933:Obscn	UTSW	11	58998505	missense	unknown
R5935:Obscn	UTSW	11	59006813	missense	unknown
R5974:Obscn	UTSW	11	59076547	missense	probably damaging	1.00
R5975:Obscn	UTSW	11	59122619	critical splice donor site	probably null
R6014:Obscn	UTSW	11	59038864	missense	probably damaging	1.00
R6026:Obscn	UTSW	11	59067090	missense	probably damaging	0.98
R6082:Obscn	UTSW	11	58999567	missense	unknown
R6124:Obscn	UTSW	11	59079044	missense	probably benign	0.45
R6130:Obscn	UTSW	11	59077945	missense	possibly damaging	0.90
R6160:Obscn	UTSW	11	59051785	missense	probably damaging	1.00
R6169:Obscn	UTSW	11	59000499	missense	unknown
R6177:Obscn	UTSW	11	59032664	missense	probably damaging	1.00
R6189:Obscn	UTSW	11	59069934	missense	probably benign	0.00
R6192:Obscn	UTSW	11	58998038	missense	unknown
R6195:Obscn	UTSW	11	58997207	missense	probably damaging	0.98
R6208:Obscn	UTSW	11	59067648	missense	possibly damaging	0.81
R6232:Obscn	UTSW	11	59052511	nonsense	probably null
R6233:Obscn	UTSW	11	58997207	missense	probably damaging	0.98
R6273:Obscn	UTSW	11	59076993	missense	possibly damaging	0.95
R6280:Obscn	UTSW	11	59063683	missense	possibly damaging	0.82
R6317:Obscn	UTSW	11	59069895	missense	probably damaging	1.00
R6345:Obscn	UTSW	11	59053696	missense	probably damaging	0.99
R6378:Obscn	UTSW	11	59073746	missense	probably damaging	1.00
R6382:Obscn	UTSW	11	58999413	missense	unknown
R6382:Obscn	UTSW	11	59042208	missense	probably damaging	0.99
R6415:Obscn	UTSW	11	59035130	missense	probably damaging	0.99
R6433:Obscn	UTSW	11	59051558	missense	probably benign	0.14
R6457:Obscn	UTSW	11	59080771	missense	probably damaging	0.99
R6508:Obscn	UTSW	11	59054147	splice site	probably null
R6611:Obscn	UTSW	11	59064230	splice site	probably null
R6614:Obscn	UTSW	11	59012801	missense	probably benign	0.01
R6645:Obscn	UTSW	11	59085262	missense	probably damaging	0.97
R6646:Obscn	UTSW	11	59082718	missense	possibly damaging	0.72
R6659:Obscn	UTSW	11	59039009	missense	probably damaging	1.00
R6723:Obscn	UTSW	11	59054998	missense	probably damaging	0.99
R6733:Obscn	UTSW	11	59028595	missense	probably damaging	0.99
R6755:Obscn	UTSW	11	59103326	missense	probably damaging	1.00
R6770:Obscn	UTSW	11	59044036	missense	possibly damaging	0.88
R6820:Obscn	UTSW	11	59051193	missense	probably damaging	1.00
R6823:Obscn	UTSW	11	59067943	critical splice donor site	probably null
R6850:Obscn	UTSW	11	59002129	missense	possibly damaging	0.92
R6850:Obscn	UTSW	11	59068124	missense	possibly damaging	0.93
R6862:Obscn	UTSW	11	58995453	unclassified	probably benign
R6884:Obscn	UTSW	11	59078302	missense	probably damaging	1.00
R6894:Obscn	UTSW	11	59132682	missense	probably benign	0.43
R6906:Obscn	UTSW	11	59032918	missense	possibly damaging	0.85
R6944:Obscn	UTSW	11	59038930	missense	probably damaging	1.00
R6948:Obscn	UTSW	11	59106316	missense	probably damaging	1.00
R6959:Obscn	UTSW	11	59037585	missense	probably damaging	1.00
R7000:Obscn	UTSW	11	59136038	missense	probably damaging	1.00
R7028:Obscn	UTSW	11	59079133	missense	probably damaging	1.00
R7037:Obscn	UTSW	11	59043929	missense	probably damaging	1.00
R7037:Obscn	UTSW	11	59052604	missense	probably damaging	0.98
R7056:Obscn	UTSW	11	58996296	unclassified	probably benign
R7112:Obscn	UTSW	11	59029325	missense
R7121:Obscn	UTSW	11	59013252	nonsense	probably null
R7123:Obscn	UTSW	11	59013651	missense	probably benign
R7182:Obscn	UTSW	11	59035101	missense	probably damaging	0.99
R7199:Obscn	UTSW	11	59012846	missense	probably benign	0.09
R7209:Obscn	UTSW	11	59085107	nonsense	probably null
R7235:Obscn	UTSW	11	59080840	missense	probably damaging	0.98
R7247:Obscn	UTSW	11	59103318	nonsense	probably null
R7262:Obscn	UTSW	11	59115889	missense	probably damaging	0.99
R7269:Obscn	UTSW	11	59043012	missense	probably damaging	0.99
R7270:Obscn	UTSW	11	59029486	missense
R7274:Obscn	UTSW	11	59133227	missense	probably damaging	1.00
R7312:Obscn	UTSW	11	59055616	missense	probably benign	0.00
R7313:Obscn	UTSW	11	59007588	missense	unknown
R7360:Obscn	UTSW	11	59082359	missense	probably damaging	1.00
R7380:Obscn	UTSW	11	59056914	missense
R7389:Obscn	UTSW	11	59036400	missense	probably benign	0.02
R7402:Obscn	UTSW	11	58995449	missense	unknown
R7417:Obscn	UTSW	11	59129577	missense	possibly damaging	0.93
R7432:Obscn	UTSW	11	59028907	missense
R7456:Obscn	UTSW	11	59008558	missense	probably benign	0.01
R7459:Obscn	UTSW	11	59131657	missense	probably benign	0.00
R7463:Obscn	UTSW	11	59122860	missense	probably benign	0.02
R7478:Obscn	UTSW	11	59093416	missense	probably damaging	1.00
R7498:Obscn	UTSW	11	59082713	missense	probably damaging	1.00
R7502:Obscn	UTSW	11	58994809	missense	unknown
R7509:Obscn	UTSW	11	59051629	missense	probably benign	0.36
R7516:Obscn	UTSW	11	59124590	nonsense	probably null
R7545:Obscn	UTSW	11	59038899	missense	probably damaging	1.00
R7549:Obscn	UTSW	11	59042838	critical splice donor site	probably null
R7582:Obscn	UTSW	11	59061427	nonsense	probably null
R7607:Obscn	UTSW	11	58998265	missense	unknown
R7609:Obscn	UTSW	11	59000299	missense	unknown
R7647:Obscn	UTSW	11	58997287	critical splice acceptor site	probably null
R7650:Obscn	UTSW	11	59060994	missense	probably benign	0.01
R7673:Obscn	UTSW	11	59027437	missense
R7743:Obscn	UTSW	11	59099777	missense	probably damaging	1.00
R7745:Obscn	UTSW	11	59060855	missense	probably damaging	1.00
R7823:Obscn	UTSW	11	59107940	missense	probably damaging	1.00
R7840:Obscn	UTSW	11	59077950	missense	possibly damaging	0.88
R7854:Obscn	UTSW	11	59090712	missense	probably benign	0.14
R7867:Obscn	UTSW	11	59000826	missense	unknown
R7874:Obscn	UTSW	11	59133276	missense	probably damaging	1.00
R7877:Obscn	UTSW	11	59133762	missense	probably damaging	1.00
R7883:Obscn	UTSW	11	59070009	nonsense	probably null
R7903:Obscn	UTSW	11	59079116	missense	probably benign	0.15
R7924:Obscn	UTSW	11	59112555	missense	probably benign	0.27
R7925:Obscn	UTSW	11	59112555	missense	probably benign	0.27
R7936:Obscn	UTSW	11	59050508	missense	possibly damaging	0.46
R7944:Obscn	UTSW	11	59093409	missense	probably damaging	1.00
R7945:Obscn	UTSW	11	59093409	missense	probably damaging	1.00
R7984:Obscn	UTSW	11	59106325	missense	possibly damaging	0.91
R8042:Obscn	UTSW	11	59040317	missense	possibly damaging	0.61
R8073:Obscn	UTSW	11	59135690	missense	probably benign	0.25
R8079:Obscn	UTSW	11	59081905	missense	possibly damaging	0.84
R8108:Obscn	UTSW	11	59061634	missense	probably benign	0.17
R8117:Obscn	UTSW	11	59042154	missense	possibly damaging	0.91
R8130:Obscn	UTSW	11	59124613	missense	probably damaging	1.00
R8135:Obscn	UTSW	11	59031877	missense	possibly damaging	0.60
R8175:Obscn	UTSW	11	58995960	missense	unknown
R8205:Obscn	UTSW	11	59007871	missense	unknown
R8211:Obscn	UTSW	11	59115794	missense	probably damaging	0.99
R8219:Obscn	UTSW	11	59122748	missense	probably benign	0.03
R8245:Obscn	UTSW	11	59022240	missense
R8290:Obscn	UTSW	11	59062710	missense	probably damaging	1.00
R8290:Obscn	UTSW	11	59124574	missense	probably damaging	0.99
R8300:Obscn	UTSW	11	59043070	missense	probably benign	0.02
R8346:Obscn	UTSW	11	59085181	missense	possibly damaging	0.80
R8384:Obscn	UTSW	11	59085109	missense	probably damaging	0.98
R8390:Obscn	UTSW	11	59002044	missense	probably benign	0.03
R8396:Obscn	UTSW	11	59003003	missense	probably benign	0.03
R8443:Obscn	UTSW	11	59038874	missense	probably damaging	0.99
R8469:Obscn	UTSW	11	59128237	missense	probably damaging	1.00
R8503:Obscn	UTSW	11	59000617	missense	unknown
X0010:Obscn	UTSW	11	58995553	unclassified	probably benign
X0012:Obscn	UTSW	11	59006776	missense	unknown
X0021:Obscn	UTSW	11	59077906	missense	probably damaging	0.96
X0058:Obscn	UTSW	11	59035968	missense	probably damaging	1.00
X0061:Obscn	UTSW	11	59077830	missense	probably damaging	1.00
X0063:Obscn	UTSW	11	59000056	missense	unknown
X0067:Obscn	UTSW	11	59131801	missense	probably benign	0.19
Y4336:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y4337:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y4338:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y5407:Obscn	UTSW	11	59021943	missense	probably damaging	0.97
Z1176:Obscn	UTSW	11	58994372	missense	unknown
Z1176:Obscn	UTSW	11	58995530	missense	unknown
Z1176:Obscn	UTSW	11	59038807	missense	probably damaging	1.00
Z1176:Obscn	UTSW	11	59040347	missense	probably benign	0.39
Z1176:Obscn	UTSW	11	59049725	missense	probably benign	0.01
Z1176:Obscn	UTSW	11	59082823	missense	probably benign	0.25
Z1176:Obscn	UTSW	11	59136286	missense	probably benign	0.39
Z1177:Obscn	UTSW	11	59000955	missense	probably benign	0.04
Z1177:Obscn	UTSW	11	59010444	missense
Z1177:Obscn	UTSW	11	59051543	missense	probably damaging	0.98
Z1177:Obscn	UTSW	11	59055490	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59056039	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59061015	missense	possibly damaging	0.68
Z1177:Obscn	UTSW	11	59062087	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59062887	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59135466	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CATCTTTTATTAGCGGGTGTCC -3'
(R):5'- AAGGAGCTCAACCTGTGTCC -3'

Sequencing Primer
(F):5'- TCCCCGCATGTGGCATG -3'
(R):5'- TCCACTGCTCTGGCTGG -3'

Posted On

2014-11-12