Incidental Mutation 'R2424:Tbp'
ID249513
Institutional Source Beutler Lab
Gene Symbol Tbp
Ensembl Gene ENSMUSG00000014767
Gene NameTATA box binding protein
SynonymsGtf2d
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2424 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15499888-15528379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15513533 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 174 (F174L)
Ref Sequence ENSEMBL: ENSMUSP00000113999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014911] [ENSMUST00000117593] [ENSMUST00000118001] [ENSMUST00000119879] [ENSMUST00000153480] [ENSMUST00000162505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014911
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014911
Gene: ENSMUSG00000014767
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117593
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112794
Gene: ENSMUSG00000014767
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118001
AA Change: F174L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113999
Gene: ENSMUSG00000014767
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 204 1.4e-29 PFAM
Pfam:TBP 203 257 4.4e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119879
AA Change: F174L

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114007
Gene: ENSMUSG00000014767
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 8.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153480
SMART Domains Protein: ENSMUSP00000114471
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
Pfam:TBP 30 114 5e-35 PFAM
Pfam:TBP 119 205 4.4e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162505
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 139 221 1.1e-34 PFAM
Pfam:TBP 229 312 8.5e-34 PFAM
Meta Mutation Damage Score 0.3930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit embryonic lethality caused by hemorrhaging and clotting in the placenta and surviving embryos die prior to weaning. Mice homozygous for another null allele undergo growth arrest after hatching and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Tbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Tbp APN 17 15504616 missense probably damaging 1.00
R5288:Tbp UTSW 17 15507347 missense probably benign 0.06
R6343:Tbp UTSW 17 15501089 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGTTCGACAAACTTGCACAGTTC -3'
(R):5'- CTAGCCTGATAACAGAAGGACG -3'

Sequencing Primer
(F):5'- TTCGACAAACTTGCACAGTTCAAAAG -3'
(R):5'- CCTGATAACAGAAGGACGCTAGAGC -3'
Posted On2014-11-12