Mutagenetix > Incidental Mutation

Incidental Mutation 'R2424:Tbp'

249513

Institutional Source

Beutler Lab

Gene Symbol

Tbp

Ensembl Gene

ENSMUSG00000014767

Gene Name

TATA box binding protein

Synonyms

Gtf2d

MMRRC Submission

040386-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2424 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15720150-15737689 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15733795 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 174 (F174L)

Ref Sequence

ENSEMBL: ENSMUSP00000113999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014911] [ENSMUST00000117593] [ENSMUST00000118001] [ENSMUST00000119879] [ENSMUST00000153480] [ENSMUST00000162505]

AlphaFold

P29037

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014911
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000014911
Gene: ENSMUSG00000014767
AA Change: F174L

Domain	Start	End	E-Value	Type
low complexity region	55	97	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	117	133	N/A	INTRINSIC
Pfam:TBP	138	222	4.3e-34	PFAM
Pfam:TBP	227	313	3.4e-35	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117593
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112794
Gene: ENSMUSG00000014767
AA Change: F174L

Domain	Start	End	E-Value	Type
low complexity region	55	97	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	117	133	N/A	INTRINSIC
Pfam:TBP	138	222	4.3e-34	PFAM
Pfam:TBP	227	313	3.4e-35	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118001
AA Change: F174L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113999
Gene: ENSMUSG00000014767
AA Change: F174L

Domain	Start	End	E-Value	Type
low complexity region	55	97	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	117	133	N/A	INTRINSIC
Pfam:TBP	138	204	1.4e-29	PFAM
Pfam:TBP	203	257	4.4e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119879
AA Change: F174L

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114007
Gene: ENSMUSG00000014767
AA Change: F174L

Domain	Start	End	E-Value	Type
low complexity region	55	97	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	117	133	N/A	INTRINSIC
Pfam:TBP	138	222	8.9e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153480

SMART Domains

Protein: ENSMUSP00000114471
Gene: ENSMUSG00000014767

Domain	Start	End	E-Value	Type
Pfam:TBP	30	114	5e-35	PFAM
Pfam:TBP	119	205	4.4e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162505
AA Change: F174L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767
AA Change: F174L

Domain	Start	End	E-Value	Type
low complexity region	55	97	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	117	133	N/A	INTRINSIC
Pfam:TBP	139	221	1.1e-34	PFAM
Pfam:TBP	229	312	8.5e-34	PFAM

Meta Mutation Damage Score

0.3930

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit embryonic lethality caused by hemorrhaging and clotting in the placenta and surviving embryos die prior to weaning. Mice homozygous for another null allele undergo growth arrest after hatching and apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	A	G	5: 125,590,159 (GRCm39)		probably null	Het
Acot3	G	T	12: 84,100,638 (GRCm39)	R138L	probably damaging	Het
Ago3	A	G	4: 126,298,040 (GRCm39)	V160A	probably damaging	Het
Akap9	A	C	5: 4,115,279 (GRCm39)	E166D	probably damaging	Het
Arid5a	T	C	1: 36,357,582 (GRCm39)	Y136H	probably damaging	Het
Ascc3	T	C	10: 50,494,297 (GRCm39)	V244A	probably benign	Het
Atp10a	A	T	7: 58,444,303 (GRCm39)	H560L	probably benign	Het
Btbd6	A	G	12: 112,941,980 (GRCm39)	T482A	probably benign	Het
Cacna1d	A	T	14: 29,770,980 (GRCm39)	Y1828N	probably damaging	Het
Capzb	A	G	4: 138,921,441 (GRCm39)	M1V	probably null	Het
Cdh9	T	G	15: 16,850,440 (GRCm39)	F524L	probably damaging	Het
Ctnna1	T	C	18: 35,386,760 (GRCm39)	S846P	probably benign	Het
Dab1	C	T	4: 104,588,948 (GRCm39)	A524V	probably benign	Het
Dock7	T	A	4: 98,833,544 (GRCm39)	R1886*	probably null	Het
Dpp3	A	T	19: 4,957,735 (GRCm39)	L711*	probably null	Het
Dst	T	A	1: 34,206,141 (GRCm39)	I566N	probably damaging	Het
Eif2b3	T	A	4: 116,928,045 (GRCm39)	S421R	probably benign	Het
Epg5	T	C	18: 78,011,828 (GRCm39)	V825A	probably benign	Het
Eya1	T	A	1: 14,341,072 (GRCm39)		probably benign	Het
Fam187a	T	C	11: 102,776,780 (GRCm39)	Y195H	probably damaging	Het
Fbn2	C	T	18: 58,336,859 (GRCm39)	C132Y	probably damaging	Het
Fbxw21	A	T	9: 108,986,587 (GRCm39)	Y97*	probably null	Het
Grin1	A	T	2: 25,208,664 (GRCm39)	C79S	probably null	Het
Haao	T	A	17: 84,142,991 (GRCm39)	Y118F	probably damaging	Het
Il11ra1	T	A	4: 41,768,222 (GRCm39)	S378T	probably damaging	Het
Kcnj5	A	T	9: 32,234,116 (GRCm39)	N66K	probably damaging	Het
Kif21a	T	A	15: 90,855,399 (GRCm39)	N668I	probably damaging	Het
Kprp	A	T	3: 92,732,912 (GRCm39)	L46Q	probably damaging	Het
Lama1	C	T	17: 68,105,660 (GRCm39)	T2056I	probably benign	Het
Madd	G	C	2: 90,996,967 (GRCm39)	D824E	probably damaging	Het
Mapk9	A	G	11: 49,754,499 (GRCm39)	N84S	probably damaging	Het
Mrpl39	A	G	16: 84,527,748 (GRCm39)	V160A	probably benign	Het
Mrpl9	T	C	3: 94,351,113 (GRCm39)	S98P	probably benign	Het
Mybpc3	A	T	2: 90,966,138 (GRCm39)	M1233L	probably benign	Het
Neb	A	G	2: 52,099,671 (GRCm39)		probably benign	Het
Ngly1	A	G	14: 16,290,721 (GRCm38)		probably null	Het
Nt5c1b	A	T	12: 10,420,072 (GRCm39)	T4S	probably damaging	Het
Obscn	T	C	11: 58,885,277 (GRCm39)		probably benign	Het
Or2h2c	T	C	17: 37,422,408 (GRCm39)	I155M	probably benign	Het
Or4k15b	T	C	14: 50,272,281 (GRCm39)	Y193C	probably damaging	Het
Or8b1b	T	C	9: 38,376,128 (GRCm39)	S264P	probably damaging	Het
Or8g53	A	G	9: 39,683,593 (GRCm39)	F168L	probably benign	Het
Otog	A	T	7: 45,947,593 (GRCm39)	K64*	probably null	Het
Papola	A	G	12: 105,793,311 (GRCm39)	T544A	probably benign	Het
Phc1	A	G	6: 122,297,002 (GRCm39)	V790A	probably damaging	Het
Phf3	G	T	1: 30,845,430 (GRCm39)	R1252S	probably damaging	Het
Phf8-ps	T	C	17: 33,284,730 (GRCm39)	T691A	probably benign	Het
Plxna2	C	T	1: 194,431,625 (GRCm39)	S538F	probably damaging	Het
Rgs17	T	A	10: 5,783,111 (GRCm39)	I159F	probably damaging	Het
Rgs17	T	A	10: 5,792,560 (GRCm39)	E62V	probably benign	Het
Rnase1	A	G	14: 51,383,004 (GRCm39)	Y117H	possibly damaging	Het
Rnf214	T	C	9: 45,811,096 (GRCm39)	D189G	probably damaging	Het
Sema4b	A	G	7: 79,869,023 (GRCm39)	N365S	probably damaging	Het
Setd2	A	G	9: 110,446,590 (GRCm39)	H2480R	probably benign	Het
Slc27a6	G	T	18: 58,738,189 (GRCm39)	C415F	probably benign	Het
Stim1	A	G	7: 102,057,612 (GRCm39)	I142V	probably benign	Het
Supt5	T	C	7: 28,014,590 (GRCm39)	I1070V	possibly damaging	Het
Tex26	A	G	5: 149,393,913 (GRCm39)		probably benign	Het
Tmem132d	A	G	5: 127,941,663 (GRCm39)	V479A	probably benign	Het
Ttn	T	C	2: 76,711,489 (GRCm39)		probably benign	Het
Urb2	T	A	8: 124,757,165 (GRCm39)	N957K	probably benign	Het
Usp24	T	C	4: 106,256,310 (GRCm39)		probably null	Het
Vmn2r114	T	C	17: 23,515,842 (GRCm39)	T550A	possibly damaging	Het
Vmn2r72	A	G	7: 85,400,161 (GRCm39)	V296A	probably damaging	Het
Vmn2r91	C	A	17: 18,356,431 (GRCm39)	Y699*	probably null	Het

Other mutations in Tbp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02260:Tbp	APN	17	15,724,878 (GRCm39)	missense	probably damaging	1.00
R5288:Tbp	UTSW	17	15,727,609 (GRCm39)	missense	probably benign	0.06
R6343:Tbp	UTSW	17	15,721,351 (GRCm39)	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTCGACAAACTTGCACAGTTC -3'
(R):5'- CTAGCCTGATAACAGAAGGACG -3'

Sequencing Primer
(F):5'- TTCGACAAACTTGCACAGTTCAAAAG -3'
(R):5'- CCTGATAACAGAAGGACGCTAGAGC -3'

Posted On

2014-11-12