Incidental Mutation 'R2424:Olfr92'
ID 249517
Institutional Source Beutler Lab
Gene Symbol Olfr92
Ensembl Gene ENSMUSG00000096477
Gene Name olfactory receptor 92
Synonyms MOR256-29, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R2424 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 37110512-37120088 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37111516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 155 (I155M)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
AlphaFold L7N475
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: I155M

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: I155M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: I155M

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: I155M

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dpp3 A T 19: 4,907,707 L711* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Olfr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr92 APN 17 37111809 missense probably damaging 1.00
IGL02850:Olfr92 APN 17 37111973 missense probably benign 0.35
IGL03209:Olfr92 APN 17 37111521 missense probably benign 0.04
R0579:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0580:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0582:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0615:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0669:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0674:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0675:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R3714:Olfr92 UTSW 17 37111335 missense probably damaging 1.00
R4393:Olfr92 UTSW 17 37114084 intron probably benign
R5811:Olfr92 UTSW 17 37111757 missense probably benign 0.00
R6615:Olfr92 UTSW 17 37111602 missense probably damaging 1.00
R6853:Olfr92 UTSW 17 37111508 missense probably benign 0.02
R6876:Olfr92 UTSW 17 37111206 missense probably damaging 1.00
R7665:Olfr92 UTSW 17 37111391 missense probably benign 0.20
R8087:Olfr92 UTSW 17 37111548 missense probably benign
R9224:Olfr92 UTSW 17 37111875 missense possibly damaging 0.53
R9439:Olfr92 UTSW 17 37111313 missense probably damaging 1.00
Z1177:Olfr92 UTSW 17 37111430 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGCAATGGCACCATAAGAGAC -3'
(R):5'- GCTTCACCACAACCTGTGTC -3'

Sequencing Primer
(F):5'- CCATAAGAGACAAGGATGAGGCTC -3'
(R):5'- AAGACCATCAGCTTCCTGGGATG -3'
Posted On 2014-11-12