Incidental Mutation 'R0308:Itga10'
ID24952
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96651464 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 373 (S373P)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: S373P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: S373P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: S373P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: S373P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.6458 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACAGACATTGTGGATGCACTGGG -3'
(R):5'- TTCTTCAAGCCATAGCACGGAGCC -3'

Sequencing Primer
(F):5'- CACTGGGGGACCGAATTTTTG -3'
(R):5'- TCACATACAGGTACACTGTGGTC -3'
Posted On2013-04-16