Mutagenetix > Incidental Mutations

Incidental Mutation 'R2424:Epg5'

249523

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

040386-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R2424 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77968613 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 825 (V825A)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

Predicted Effect

probably benign
Transcript: ENSMUST00000044622
AA Change: V825A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V825A

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Meta Mutation Damage Score

0.0595

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,756	T691A	probably benign	Het
Aacs	A	G	5: 125,513,095		probably null	Het
Acot3	G	T	12: 84,053,864	R138L	probably damaging	Het
Ago3	A	G	4: 126,404,247	V160A	probably damaging	Het
Akap9	A	C	5: 4,065,279	E166D	probably damaging	Het
Arid5a	T	C	1: 36,318,501	Y136H	probably damaging	Het
Ascc3	T	C	10: 50,618,201	V244A	probably benign	Het
Atp10a	A	T	7: 58,794,555	H560L	probably benign	Het
Btbd6	A	G	12: 112,978,360	T482A	probably benign	Het
Cacna1d	A	T	14: 30,049,023	Y1828N	probably damaging	Het
Capzb	A	G	4: 139,194,130	M1V	probably null	Het
Cdh9	T	G	15: 16,850,354	F524L	probably damaging	Het
Ctnna1	T	C	18: 35,253,707	S846P	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dock7	T	A	4: 98,945,307	R1886*	probably null	Het
Dpp3	A	T	19: 4,907,707	L711*	probably null	Het
Dst	T	A	1: 34,167,060	I566N	probably damaging	Het
Eif2b3	T	A	4: 117,070,848	S421R	probably benign	Het
Eya1	T	A	1: 14,270,848		probably benign	Het
Fam187a	T	C	11: 102,885,954	Y195H	probably damaging	Het
Fbn2	C	T	18: 58,203,787	C132Y	probably damaging	Het
Fbxw21	A	T	9: 109,157,519	Y97*	probably null	Het
Grin1	A	T	2: 25,318,652	C79S	probably null	Het
Haao	T	A	17: 83,835,562	Y118F	probably damaging	Het
Il11ra1	T	A	4: 41,768,222	S378T	probably damaging	Het
Kcnj5	A	T	9: 32,322,820	N66K	probably damaging	Het
Kif21a	T	A	15: 90,971,196	N668I	probably damaging	Het
Kprp	A	T	3: 92,825,605	L46Q	probably damaging	Het
Lama1	C	T	17: 67,798,665	T2056I	probably benign	Het
Madd	G	C	2: 91,166,622	D824E	probably damaging	Het
Mapk9	A	G	11: 49,863,672	N84S	probably damaging	Het
Mrpl39	A	G	16: 84,730,860	V160A	probably benign	Het
Mrpl9	T	C	3: 94,443,806	S98P	probably benign	Het
Mybpc3	A	T	2: 91,135,793	M1233L	probably benign	Het
Neb	A	G	2: 52,209,659		probably benign	Het
Ngly1	A	G	14: 16,290,721		probably null	Het
Nt5c1b	A	T	12: 10,370,072	T4S	probably damaging	Het
Obscn	T	C	11: 58,994,451		probably benign	Het
Olfr725	T	C	14: 50,034,824	Y193C	probably damaging	Het
Olfr904	T	C	9: 38,464,832	S264P	probably damaging	Het
Olfr92	T	C	17: 37,111,516	I155M	probably benign	Het
Olfr968	A	G	9: 39,772,297	F168L	probably benign	Het
Otog	A	T	7: 46,298,169	K64*	probably null	Het
Papola	A	G	12: 105,827,052	T544A	probably benign	Het
Phc1	A	G	6: 122,320,043	V790A	probably damaging	Het
Phf3	G	T	1: 30,806,349	R1252S	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rgs17	T	A	10: 5,833,111	I159F	probably damaging	Het
Rgs17	T	A	10: 5,842,560	E62V	probably benign	Het
Rnase1	A	G	14: 51,145,547	Y117H	possibly damaging	Het
Rnf214	T	C	9: 45,899,798	D189G	probably damaging	Het
Sema4b	A	G	7: 80,219,275	N365S	probably damaging	Het
Setd2	A	G	9: 110,617,522	H2480R	probably benign	Het
Slc27a6	G	T	18: 58,605,117	C415F	probably benign	Het
Stim1	A	G	7: 102,408,405	I142V	probably benign	Het
Supt5	T	C	7: 28,315,165	I1070V	possibly damaging	Het
Tbp	T	C	17: 15,513,533	F174L	possibly damaging	Het
Tex26	A	G	5: 149,470,448		probably benign	Het
Tmem132d	A	G	5: 127,864,599	V479A	probably benign	Het
Ttn	T	C	2: 76,881,145		probably benign	Het
Urb2	T	A	8: 124,030,426	N957K	probably benign	Het
Usp24	T	C	4: 106,399,113		probably null	Het
Vmn2r114	T	C	17: 23,296,868	T550A	possibly damaging	Het
Vmn2r72	A	G	7: 85,750,953	V296A	probably damaging	Het
Vmn2r91	C	A	17: 18,136,169	Y699*	probably null	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTTTCCGAGGCTCAGTGTG -3'
(R):5'- CCAGTGTCTCATGACTTCGG -3'

Sequencing Primer
(F):5'- GAGATTATGTTTTGTGGAGCAAAGTC -3'
(R):5'- AGACAGGGTTTCTCTGTAACAGCC -3'

Posted On

2014-11-12