Incidental Mutation 'R2424:Dpp3'
ID249524
Institutional Source Beutler Lab
Gene Symbol Dpp3
Ensembl Gene ENSMUSG00000063904
Gene Namedipeptidylpeptidase 3
Synonyms4930533O14Rik
MMRRC Submission 040386-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R2424 (G1)
Quality Score190
Status Validated
Chromosome19
Chromosomal Location4907229-4928287 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4907707 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 711 (L711*)
Ref Sequence ENSEMBL: ENSMUSP00000025851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851] [ENSMUST00000053506]
Predicted Effect probably null
Transcript: ENSMUST00000025851
AA Change: L711*
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904
AA Change: L711*

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053506
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158036
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,756 T691A probably benign Het
Aacs A G 5: 125,513,095 probably null Het
Acot3 G T 12: 84,053,864 R138L probably damaging Het
Ago3 A G 4: 126,404,247 V160A probably damaging Het
Akap9 A C 5: 4,065,279 E166D probably damaging Het
Arid5a T C 1: 36,318,501 Y136H probably damaging Het
Ascc3 T C 10: 50,618,201 V244A probably benign Het
Atp10a A T 7: 58,794,555 H560L probably benign Het
Btbd6 A G 12: 112,978,360 T482A probably benign Het
Cacna1d A T 14: 30,049,023 Y1828N probably damaging Het
Capzb A G 4: 139,194,130 M1V probably null Het
Cdh9 T G 15: 16,850,354 F524L probably damaging Het
Ctnna1 T C 18: 35,253,707 S846P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 T A 4: 98,945,307 R1886* probably null Het
Dst T A 1: 34,167,060 I566N probably damaging Het
Eif2b3 T A 4: 117,070,848 S421R probably benign Het
Epg5 T C 18: 77,968,613 V825A probably benign Het
Eya1 T A 1: 14,270,848 probably benign Het
Fam187a T C 11: 102,885,954 Y195H probably damaging Het
Fbn2 C T 18: 58,203,787 C132Y probably damaging Het
Fbxw21 A T 9: 109,157,519 Y97* probably null Het
Grin1 A T 2: 25,318,652 C79S probably null Het
Haao T A 17: 83,835,562 Y118F probably damaging Het
Il11ra1 T A 4: 41,768,222 S378T probably damaging Het
Kcnj5 A T 9: 32,322,820 N66K probably damaging Het
Kif21a T A 15: 90,971,196 N668I probably damaging Het
Kprp A T 3: 92,825,605 L46Q probably damaging Het
Lama1 C T 17: 67,798,665 T2056I probably benign Het
Madd G C 2: 91,166,622 D824E probably damaging Het
Mapk9 A G 11: 49,863,672 N84S probably damaging Het
Mrpl39 A G 16: 84,730,860 V160A probably benign Het
Mrpl9 T C 3: 94,443,806 S98P probably benign Het
Mybpc3 A T 2: 91,135,793 M1233L probably benign Het
Neb A G 2: 52,209,659 probably benign Het
Ngly1 A G 14: 16,290,721 probably null Het
Nt5c1b A T 12: 10,370,072 T4S probably damaging Het
Obscn T C 11: 58,994,451 probably benign Het
Olfr725 T C 14: 50,034,824 Y193C probably damaging Het
Olfr904 T C 9: 38,464,832 S264P probably damaging Het
Olfr92 T C 17: 37,111,516 I155M probably benign Het
Olfr968 A G 9: 39,772,297 F168L probably benign Het
Otog A T 7: 46,298,169 K64* probably null Het
Papola A G 12: 105,827,052 T544A probably benign Het
Phc1 A G 6: 122,320,043 V790A probably damaging Het
Phf3 G T 1: 30,806,349 R1252S probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs17 T A 10: 5,833,111 I159F probably damaging Het
Rgs17 T A 10: 5,842,560 E62V probably benign Het
Rnase1 A G 14: 51,145,547 Y117H possibly damaging Het
Rnf214 T C 9: 45,899,798 D189G probably damaging Het
Sema4b A G 7: 80,219,275 N365S probably damaging Het
Setd2 A G 9: 110,617,522 H2480R probably benign Het
Slc27a6 G T 18: 58,605,117 C415F probably benign Het
Stim1 A G 7: 102,408,405 I142V probably benign Het
Supt5 T C 7: 28,315,165 I1070V possibly damaging Het
Tbp T C 17: 15,513,533 F174L possibly damaging Het
Tex26 A G 5: 149,470,448 probably benign Het
Tmem132d A G 5: 127,864,599 V479A probably benign Het
Ttn T C 2: 76,881,145 probably benign Het
Urb2 T A 8: 124,030,426 N957K probably benign Het
Usp24 T C 4: 106,399,113 probably null Het
Vmn2r114 T C 17: 23,296,868 T550A possibly damaging Het
Vmn2r72 A G 7: 85,750,953 V296A probably damaging Het
Vmn2r91 C A 17: 18,136,169 Y699* probably null Het
Other mutations in Dpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Dpp3 APN 19 4913892 missense probably benign 0.00
IGL01657:Dpp3 APN 19 4918304 missense possibly damaging 0.72
IGL02105:Dpp3 APN 19 4916771 missense probably damaging 1.00
IGL02251:Dpp3 APN 19 4918315 missense probably benign
IGL02669:Dpp3 APN 19 4923682 critical splice donor site probably null
IGL02739:Dpp3 APN 19 4923728 missense probably damaging 1.00
IGL02851:Dpp3 APN 19 4923131 missense probably benign 0.06
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0053:Dpp3 UTSW 19 4923126 missense probably damaging 0.99
R0505:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R0681:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R1163:Dpp3 UTSW 19 4914923 nonsense probably null
R1200:Dpp3 UTSW 19 4923129 missense probably benign
R1761:Dpp3 UTSW 19 4921149 missense probably benign 0.37
R1931:Dpp3 UTSW 19 4917860 splice site probably benign
R2255:Dpp3 UTSW 19 4918319 missense probably benign
R3718:Dpp3 UTSW 19 4923065 critical splice donor site probably null
R3727:Dpp3 UTSW 19 4923185 missense probably benign 0.30
R5080:Dpp3 UTSW 19 4915080 missense probably benign 0.00
R5587:Dpp3 UTSW 19 4918267 missense probably damaging 0.98
R5786:Dpp3 UTSW 19 4918322 missense possibly damaging 0.53
R5986:Dpp3 UTSW 19 4918357 missense probably benign 0.18
R6128:Dpp3 UTSW 19 4922392 missense probably benign 0.05
R6989:Dpp3 UTSW 19 4921167 missense probably damaging 1.00
R7019:Dpp3 UTSW 19 4916789 missense possibly damaging 0.83
R7070:Dpp3 UTSW 19 4918328 missense probably benign 0.24
R7100:Dpp3 UTSW 19 4918041 missense probably damaging 1.00
R7265:Dpp3 UTSW 19 4923769 missense probably damaging 1.00
R7495:Dpp3 UTSW 19 4917913 missense probably damaging 1.00
R7916:Dpp3 UTSW 19 4917024 nonsense probably null
Z1176:Dpp3 UTSW 19 4922341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCACCAAAGTCCAAGC -3'
(R):5'- CCTTCCTGGCAGGGTTATTC -3'

Sequencing Primer
(F):5'- AGTCCAAGCTCCTGCCC -3'
(R):5'- CCTGAACATTGACAGTTTGTGC -3'
Posted On2014-11-12