Incidental Mutation 'R2435:Ugt2b5'
ID 249539
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms Udpgt-3, m-1
MMRRC Submission 040396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2435 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87124960-87140318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87139606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067790
AA Change: D234G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: D234G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113327
AA Change: D245G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108953
Gene: ENSMUSG00000054630
AA Change: D245G

DomainStartEndE-ValueType
Pfam:UDPGT 35 538 1.3e-259 PFAM
Pfam:Glyco_tran_28_C 341 460 4.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,920,894 T226I probably benign Het
Acvr1 T C 2: 58,479,692 N102D probably damaging Het
Cd34 T A 1: 194,939,026 C21S probably damaging Het
Cdh18 C T 15: 23,367,008 R267W probably damaging Het
Ckap5 T A 2: 91,581,145 N966K probably benign Het
Clec4e A G 6: 123,288,896 V44A probably damaging Het
Cubn T A 2: 13,318,272 N2828I probably damaging Het
Dnah10 G T 5: 124,762,865 probably null Het
Fshr A T 17: 89,200,596 V6D unknown Het
Gcc2 A G 10: 58,294,780 D1398G probably damaging Het
Gm13119 A T 4: 144,362,903 I264F possibly damaging Het
Gpi1 G A 7: 34,205,829 A390V probably damaging Het
Gypa G T 8: 80,506,768 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifna13 T A 4: 88,644,129 Q86L probably damaging Het
Itgae T A 11: 73,121,937 C698* probably null Het
Ivns1abp T C 1: 151,363,310 V625A probably benign Het
Kcnh2 A G 5: 24,326,347 probably null Het
Kcnj6 G A 16: 94,762,679 T320M probably damaging Het
Mblac2 T C 13: 81,750,249 I248T probably damaging Het
Muc5ac A T 7: 141,818,104 Y2647F possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr727 T C 14: 50,126,754 M59T probably damaging Het
Olfr815 G T 10: 129,902,304 N135K possibly damaging Het
Pard3b T A 1: 62,587,738 V1059E probably damaging Het
Pkd1l3 A C 8: 109,650,702 I1585L probably benign Het
Prrc2b A T 2: 32,219,729 S1791C probably damaging Het
Rbmxl2 C A 7: 107,210,331 S274R probably damaging Het
Serpini2 T C 3: 75,258,168 E168G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis A G 3: 72,911,904 S1440P probably benign Het
Snrnp40 A G 4: 130,384,551 H283R probably damaging Het
Tcaf2 G T 6: 42,630,364 Q219K possibly damaging Het
Tenm3 C T 8: 48,287,953 R803H probably damaging Het
Unc13d A G 11: 116,068,688 F653S probably damaging Het
Unc93b1 A G 19: 3,936,373 I136V possibly damaging Het
Utp20 A G 10: 88,820,891 S151P possibly damaging Het
Vmn2r50 C A 7: 10,053,099 W27L probably benign Het
Zan T C 5: 137,438,574 S2006G unknown Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87125219 missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87127814 missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87136209 missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87137245 missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87139900 missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87127676 critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87137232 missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87128350 missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87140258 missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87137365 critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87139768 missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87139618 missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87139630 missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87127772 missense probably benign 0.18
R2389:Ugt2b5 UTSW 5 87127682 missense probably damaging 0.98
R2919:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R2920:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87139763 nonsense probably null
R4380:Ugt2b5 UTSW 5 87127894 missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87139691 missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87139673 missense probably benign 0.00
R5731:Ugt2b5 UTSW 5 87140252 nonsense probably null
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6491:Ugt2b5 UTSW 5 87125469 nonsense probably null
R7015:Ugt2b5 UTSW 5 87139796 missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87128399 missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87125272 missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87140249 missense probably benign 0.11
R8384:Ugt2b5 UTSW 5 87140065 missense probably benign
R8465:Ugt2b5 UTSW 5 87139659 missense possibly damaging 0.79
R9336:Ugt2b5 UTSW 5 87137271 missense probably benign 0.00
X0004:Ugt2b5 UTSW 5 87128371 nonsense probably null
X0021:Ugt2b5 UTSW 5 87136211 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGGACTGATACTGATACCTTCTC -3'
(R):5'- TCTCTCCAGGCTACCAAATTG -3'

Sequencing Primer
(F):5'- TGATACTGATACCTTCTCCTGTTTG -3'
(R):5'- TGAAAAGTCCAGCGGGAGATTTCTAC -3'
Posted On 2014-11-12