Incidental Mutation 'R2435:Clec4e'
ID249544
Institutional Source Beutler Lab
Gene Symbol Clec4e
Ensembl Gene ENSMUSG00000030142
Gene NameC-type lectin domain family 4, member e
SynonymsClecsf9, Mincle
MMRRC Submission 040396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2435 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123281789-123289870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123288896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000135682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032239] [ENSMUST00000176096] [ENSMUST00000177367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032239
AA Change: V44A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032239
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
CLECT 80 206 4.82e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175995
Predicted Effect probably damaging
Transcript: ENSMUST00000176096
AA Change: V44A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135682
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176831
Predicted Effect possibly damaging
Transcript: ENSMUST00000177367
AA Change: V44A

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135081
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
CLECT 51 177 4.82e-36 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit reduced cytokine (TNF) production after challenge with C. albicans and are more susceptible to systemic candidiasis. The majority of homozygotes also display histological evidence of abnormal heart valves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,920,894 T226I probably benign Het
Acvr1 T C 2: 58,479,692 N102D probably damaging Het
Cd34 T A 1: 194,939,026 C21S probably damaging Het
Cdh18 C T 15: 23,367,008 R267W probably damaging Het
Ckap5 T A 2: 91,581,145 N966K probably benign Het
Cubn T A 2: 13,318,272 N2828I probably damaging Het
Dnah10 G T 5: 124,762,865 probably null Het
Fshr A T 17: 89,200,596 V6D unknown Het
Gcc2 A G 10: 58,294,780 D1398G probably damaging Het
Gm13119 A T 4: 144,362,903 I264F possibly damaging Het
Gpi1 G A 7: 34,205,829 A390V probably damaging Het
Gypa G T 8: 80,506,768 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifna13 T A 4: 88,644,129 Q86L probably damaging Het
Itgae T A 11: 73,121,937 C698* probably null Het
Ivns1abp T C 1: 151,363,310 V625A probably benign Het
Kcnh2 A G 5: 24,326,347 probably null Het
Kcnj6 G A 16: 94,762,679 T320M probably damaging Het
Mblac2 T C 13: 81,750,249 I248T probably damaging Het
Muc5ac A T 7: 141,818,104 Y2647F possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr727 T C 14: 50,126,754 M59T probably damaging Het
Olfr815 G T 10: 129,902,304 N135K possibly damaging Het
Pard3b T A 1: 62,587,738 V1059E probably damaging Het
Pkd1l3 A C 8: 109,650,702 I1585L probably benign Het
Prrc2b A T 2: 32,219,729 S1791C probably damaging Het
Rbmxl2 C A 7: 107,210,331 S274R probably damaging Het
Serpini2 T C 3: 75,258,168 E168G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis A G 3: 72,911,904 S1440P probably benign Het
Snrnp40 A G 4: 130,384,551 H283R probably damaging Het
Tcaf2 G T 6: 42,630,364 Q219K possibly damaging Het
Tenm3 C T 8: 48,287,953 R803H probably damaging Het
Ugt2b5 T C 5: 87,139,606 D234G probably damaging Het
Unc13d A G 11: 116,068,688 F653S probably damaging Het
Unc93b1 A G 19: 3,936,373 I136V possibly damaging Het
Utp20 A G 10: 88,820,891 S151P possibly damaging Het
Vmn2r50 C A 7: 10,053,099 W27L probably benign Het
Zan T C 5: 137,438,574 S2006G unknown Het
Other mutations in Clec4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02713:Clec4e APN 6 123286304 nonsense probably null
IGL03051:Clec4e APN 6 123289733 missense probably benign 0.02
IGL03201:Clec4e APN 6 123283640 missense probably benign 0.03
R0583:Clec4e UTSW 6 123283694 missense probably damaging 1.00
R1467:Clec4e UTSW 6 123285461 splice site probably benign
R1818:Clec4e UTSW 6 123285493 missense possibly damaging 0.87
R1826:Clec4e UTSW 6 123283632 missense probably damaging 1.00
R1968:Clec4e UTSW 6 123283574 missense probably damaging 1.00
R4530:Clec4e UTSW 6 123289774 utr 5 prime probably benign
R6891:Clec4e UTSW 6 123283606 missense probably damaging 1.00
R7531:Clec4e UTSW 6 123285574 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGCCCATGTTAAACCCAAC -3'
(R):5'- TTCTGGGTGAGGACCAACAG -3'

Sequencing Primer
(F):5'- TGGCCCATGTTAAACCCAACTAAAC -3'
(R):5'- GTGAGGACCAACAGTCTCCAG -3'
Posted On2014-11-12