Incidental Mutation 'R2435:Clec4e'
ID 249544
Institutional Source Beutler Lab
Gene Symbol Clec4e
Ensembl Gene ENSMUSG00000030142
Gene Name C-type lectin domain family 4, member e
Synonyms Mincle, Clecsf9
MMRRC Submission 040396-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R2435 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123258748-123266829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123265855 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000135682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032239] [ENSMUST00000176096] [ENSMUST00000177367]
AlphaFold Q9R0Q8
Predicted Effect possibly damaging
Transcript: ENSMUST00000032239
AA Change: V44A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032239
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
CLECT 80 206 4.82e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175995
Predicted Effect probably damaging
Transcript: ENSMUST00000176096
AA Change: V44A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135682
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176831
Predicted Effect possibly damaging
Transcript: ENSMUST00000177367
AA Change: V44A

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135081
Gene: ENSMUSG00000030142
AA Change: V44A

DomainStartEndE-ValueType
CLECT 51 177 4.82e-36 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit reduced cytokine (TNF) production after challenge with C. albicans and are more susceptible to systemic candidiasis. The majority of homozygotes also display histological evidence of abnormal heart valves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,898,294 (GRCm39) T226I probably benign Het
Acvr1 T C 2: 58,369,704 (GRCm39) N102D probably damaging Het
Cd34 T A 1: 194,621,334 (GRCm39) C21S probably damaging Het
Cdh18 C T 15: 23,367,094 (GRCm39) R267W probably damaging Het
Ckap5 T A 2: 91,411,490 (GRCm39) N966K probably benign Het
Cubn T A 2: 13,323,083 (GRCm39) N2828I probably damaging Het
Dnah10 G T 5: 124,839,929 (GRCm39) probably null Het
Fshr A T 17: 89,508,024 (GRCm39) V6D unknown Het
Gcc2 A G 10: 58,130,602 (GRCm39) D1398G probably damaging Het
Gpi1 G A 7: 33,905,254 (GRCm39) A390V probably damaging Het
Gypa G T 8: 81,233,397 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Ifna13 T A 4: 88,562,366 (GRCm39) Q86L probably damaging Het
Itgae T A 11: 73,012,763 (GRCm39) C698* probably null Het
Ivns1abp T C 1: 151,239,061 (GRCm39) V625A probably benign Het
Kcnh2 A G 5: 24,531,345 (GRCm39) probably null Het
Kcnj6 G A 16: 94,563,538 (GRCm39) T320M probably damaging Het
Mblac2 T C 13: 81,898,368 (GRCm39) I248T probably damaging Het
Muc5ac A T 7: 141,371,841 (GRCm39) Y2647F possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4k15 T C 14: 50,364,211 (GRCm39) M59T probably damaging Het
Or6c217 G T 10: 129,738,173 (GRCm39) N135K possibly damaging Het
Pard3b T A 1: 62,626,897 (GRCm39) V1059E probably damaging Het
Pkd1l3 A C 8: 110,377,334 (GRCm39) I1585L probably benign Het
Pramel31 A T 4: 144,089,473 (GRCm39) I264F possibly damaging Het
Prrc2b A T 2: 32,109,741 (GRCm39) S1791C probably damaging Het
Rbmxl2 C A 7: 106,809,538 (GRCm39) S274R probably damaging Het
Serpini2 T C 3: 75,165,475 (GRCm39) E168G probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sis A G 3: 72,819,237 (GRCm39) S1440P probably benign Het
Snrnp40 A G 4: 130,278,344 (GRCm39) H283R probably damaging Het
Tcaf2 G T 6: 42,607,298 (GRCm39) Q219K possibly damaging Het
Tenm3 C T 8: 48,740,988 (GRCm39) R803H probably damaging Het
Ugt2b5 T C 5: 87,287,465 (GRCm39) D234G probably damaging Het
Unc13d A G 11: 115,959,514 (GRCm39) F653S probably damaging Het
Unc93b1 A G 19: 3,986,373 (GRCm39) I136V possibly damaging Het
Utp20 A G 10: 88,656,753 (GRCm39) S151P possibly damaging Het
Vmn2r50 C A 7: 9,787,026 (GRCm39) W27L probably benign Het
Zan T C 5: 137,436,836 (GRCm39) S2006G unknown Het
Other mutations in Clec4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02713:Clec4e APN 6 123,263,263 (GRCm39) nonsense probably null
IGL03051:Clec4e APN 6 123,266,692 (GRCm39) missense probably benign 0.02
IGL03201:Clec4e APN 6 123,260,599 (GRCm39) missense probably benign 0.03
R0583:Clec4e UTSW 6 123,260,653 (GRCm39) missense probably damaging 1.00
R1467:Clec4e UTSW 6 123,262,420 (GRCm39) splice site probably benign
R1818:Clec4e UTSW 6 123,262,452 (GRCm39) missense possibly damaging 0.87
R1826:Clec4e UTSW 6 123,260,591 (GRCm39) missense probably damaging 1.00
R1968:Clec4e UTSW 6 123,260,533 (GRCm39) missense probably damaging 1.00
R4530:Clec4e UTSW 6 123,266,733 (GRCm39) utr 5 prime probably benign
R6891:Clec4e UTSW 6 123,260,565 (GRCm39) missense probably damaging 1.00
R7531:Clec4e UTSW 6 123,262,533 (GRCm39) missense probably benign 0.10
R8476:Clec4e UTSW 6 123,263,235 (GRCm39) missense probably benign
R9315:Clec4e UTSW 6 123,263,214 (GRCm39) missense probably damaging 1.00
R9623:Clec4e UTSW 6 123,263,306 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGCCCATGTTAAACCCAAC -3'
(R):5'- TTCTGGGTGAGGACCAACAG -3'

Sequencing Primer
(F):5'- TGGCCCATGTTAAACCCAACTAAAC -3'
(R):5'- GTGAGGACCAACAGTCTCCAG -3'
Posted On 2014-11-12