Incidental Mutation 'R2435:Mblac2'
ID249561
Institutional Source Beutler Lab
Gene Symbol Mblac2
Ensembl Gene ENSMUSG00000051098
Gene Namemetallo-beta-lactamase domain containing 2
Synonyms
MMRRC Submission 040396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2435 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location81711341-81753275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81750249 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 248 (I248T)
Ref Sequence ENSEMBL: ENSMUSP00000051644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057598]
Predicted Effect probably damaging
Transcript: ENSMUST00000057598
AA Change: I248T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051644
Gene: ENSMUSG00000051098
AA Change: I248T

DomainStartEndE-ValueType
Lactamase_B 29 231 4.92e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224299
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,920,894 T226I probably benign Het
Acvr1 T C 2: 58,479,692 N102D probably damaging Het
Cd34 T A 1: 194,939,026 C21S probably damaging Het
Cdh18 C T 15: 23,367,008 R267W probably damaging Het
Ckap5 T A 2: 91,581,145 N966K probably benign Het
Clec4e A G 6: 123,288,896 V44A probably damaging Het
Cubn T A 2: 13,318,272 N2828I probably damaging Het
Dnah10 G T 5: 124,762,865 probably null Het
Fshr A T 17: 89,200,596 V6D unknown Het
Gcc2 A G 10: 58,294,780 D1398G probably damaging Het
Gm13119 A T 4: 144,362,903 I264F possibly damaging Het
Gpi1 G A 7: 34,205,829 A390V probably damaging Het
Gypa G T 8: 80,506,768 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifna13 T A 4: 88,644,129 Q86L probably damaging Het
Itgae T A 11: 73,121,937 C698* probably null Het
Ivns1abp T C 1: 151,363,310 V625A probably benign Het
Kcnh2 A G 5: 24,326,347 probably null Het
Kcnj6 G A 16: 94,762,679 T320M probably damaging Het
Muc5ac A T 7: 141,818,104 Y2647F possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr727 T C 14: 50,126,754 M59T probably damaging Het
Olfr815 G T 10: 129,902,304 N135K possibly damaging Het
Pard3b T A 1: 62,587,738 V1059E probably damaging Het
Pkd1l3 A C 8: 109,650,702 I1585L probably benign Het
Prrc2b A T 2: 32,219,729 S1791C probably damaging Het
Rbmxl2 C A 7: 107,210,331 S274R probably damaging Het
Serpini2 T C 3: 75,258,168 E168G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis A G 3: 72,911,904 S1440P probably benign Het
Snrnp40 A G 4: 130,384,551 H283R probably damaging Het
Tcaf2 G T 6: 42,630,364 Q219K possibly damaging Het
Tenm3 C T 8: 48,287,953 R803H probably damaging Het
Ugt2b5 T C 5: 87,139,606 D234G probably damaging Het
Unc13d A G 11: 116,068,688 F653S probably damaging Het
Unc93b1 A G 19: 3,936,373 I136V possibly damaging Het
Utp20 A G 10: 88,820,891 S151P possibly damaging Het
Vmn2r50 C A 7: 10,053,099 W27L probably benign Het
Zan T C 5: 137,438,574 S2006G unknown Het
Other mutations in Mblac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mblac2 APN 13 81750006 missense probably damaging 1.00
IGL01377:Mblac2 APN 13 81750147 missense probably damaging 1.00
IGL01767:Mblac2 APN 13 81750315 missense probably damaging 1.00
R1299:Mblac2 UTSW 13 81711726 nonsense probably null
R2006:Mblac2 UTSW 13 81711741 missense probably benign
R4031:Mblac2 UTSW 13 81750089 missense possibly damaging 0.59
R4804:Mblac2 UTSW 13 81750309 nonsense probably null
R4865:Mblac2 UTSW 13 81711976 nonsense probably null
R4906:Mblac2 UTSW 13 81711587 missense probably null
R5480:Mblac2 UTSW 13 81750276 missense possibly damaging 0.77
R7760:Mblac2 UTSW 13 81711877 missense probably benign 0.00
R8138:Mblac2 UTSW 13 81711650 missense probably damaging 1.00
Z1177:Mblac2 UTSW 13 81750167 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCACTCCAGAGGCAGTATTTG -3'
(R):5'- ACTGTTTCCAACAACATGGGG -3'

Sequencing Primer
(F):5'- AAGGTGCTCTTCAGTGGTGAC -3'
(R):5'- TTTCCAACAACATGGGGGAACTG -3'
Posted On2014-11-12