Incidental Mutation 'R2435:Olfr727'
ID249562
Institutional Source Beutler Lab
Gene Symbol Olfr727
Ensembl Gene ENSMUSG00000059488
Gene Nameolfactory receptor 727
SynonymsGA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 040396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2435 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50123186-50128746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50126754 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 59 (M59T)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
Predicted Effect probably damaging
Transcript: ENSMUST00000079142
AA Change: M59T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: M59T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205947
Predicted Effect probably damaging
Transcript: ENSMUST00000215317
AA Change: M59T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,920,894 T226I probably benign Het
Acvr1 T C 2: 58,479,692 N102D probably damaging Het
Cd34 T A 1: 194,939,026 C21S probably damaging Het
Cdh18 C T 15: 23,367,008 R267W probably damaging Het
Ckap5 T A 2: 91,581,145 N966K probably benign Het
Clec4e A G 6: 123,288,896 V44A probably damaging Het
Cubn T A 2: 13,318,272 N2828I probably damaging Het
Dnah10 G T 5: 124,762,865 probably null Het
Fshr A T 17: 89,200,596 V6D unknown Het
Gcc2 A G 10: 58,294,780 D1398G probably damaging Het
Gm13119 A T 4: 144,362,903 I264F possibly damaging Het
Gpi1 G A 7: 34,205,829 A390V probably damaging Het
Gypa G T 8: 80,506,768 probably null Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Ifna13 T A 4: 88,644,129 Q86L probably damaging Het
Itgae T A 11: 73,121,937 C698* probably null Het
Ivns1abp T C 1: 151,363,310 V625A probably benign Het
Kcnh2 A G 5: 24,326,347 probably null Het
Kcnj6 G A 16: 94,762,679 T320M probably damaging Het
Mblac2 T C 13: 81,750,249 I248T probably damaging Het
Muc5ac A T 7: 141,818,104 Y2647F possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr815 G T 10: 129,902,304 N135K possibly damaging Het
Pard3b T A 1: 62,587,738 V1059E probably damaging Het
Pkd1l3 A C 8: 109,650,702 I1585L probably benign Het
Prrc2b A T 2: 32,219,729 S1791C probably damaging Het
Rbmxl2 C A 7: 107,210,331 S274R probably damaging Het
Serpini2 T C 3: 75,258,168 E168G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis A G 3: 72,911,904 S1440P probably benign Het
Snrnp40 A G 4: 130,384,551 H283R probably damaging Het
Tcaf2 G T 6: 42,630,364 Q219K possibly damaging Het
Tenm3 C T 8: 48,287,953 R803H probably damaging Het
Ugt2b5 T C 5: 87,139,606 D234G probably damaging Het
Unc13d A G 11: 116,068,688 F653S probably damaging Het
Unc93b1 A G 19: 3,936,373 I136V possibly damaging Het
Utp20 A G 10: 88,820,891 S151P possibly damaging Het
Vmn2r50 C A 7: 10,053,099 W27L probably benign Het
Zan T C 5: 137,438,574 S2006G unknown Het
Other mutations in Olfr727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Olfr727 APN 14 50126757 missense probably damaging 1.00
IGL01306:Olfr727 APN 14 50126582 missense probably benign 0.00
ANU23:Olfr727 UTSW 14 50126582 missense probably benign 0.00
R0498:Olfr727 UTSW 14 50127293 missense probably damaging 1.00
R0574:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R1201:Olfr727 UTSW 14 50127356 missense probably damaging 1.00
R2112:Olfr727 UTSW 14 50126623 missense probably damaging 1.00
R4238:Olfr727 UTSW 14 50127432 missense probably benign
R4611:Olfr727 UTSW 14 50127073 missense probably benign 0.12
R4663:Olfr727 UTSW 14 50127482 missense probably benign 0.00
R4672:Olfr727 UTSW 14 50127257 missense probably benign 0.02
R5022:Olfr727 UTSW 14 50127012 missense possibly damaging 0.78
R5062:Olfr727 UTSW 14 50127437 missense probably damaging 1.00
R5924:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R6702:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R6703:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R7497:Olfr727 UTSW 14 50127495 missense probably benign 0.20
R7615:Olfr727 UTSW 14 50126989 missense probably benign 0.07
R7798:Olfr727 UTSW 14 50127438 missense probably damaging 1.00
R8413:Olfr727 UTSW 14 50127370 missense probably benign 0.19
R8439:Olfr727 UTSW 14 50127147 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTTCCATTCAGATAGTTGAAGG -3'
(R):5'- ACATAGCGATCATAGGCCATG -3'

Sequencing Primer
(F):5'- GGTAACTCTCTTCCAAAGTCAATG -3'
(R):5'- CATAGCGATCATAGGCCATGGATAC -3'
Posted On2014-11-12