Incidental Mutation 'R2436:Wdr78'
ID249574
Institutional Source Beutler Lab
Gene Symbol Wdr78
Ensembl Gene ENSMUSG00000035126
Gene NameWD repeat domain 78
Synonyms
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location103038065-103114555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103066352 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 427 (I427V)
Ref Sequence ENSEMBL: ENSMUSP00000112018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036451] [ENSMUST00000036557] [ENSMUST00000106868] [ENSMUST00000116316]
Predicted Effect probably benign
Transcript: ENSMUST00000036451
AA Change: I427V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000037588
Gene: ENSMUSG00000035126
AA Change: I427V

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036557
AA Change: I104V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042272
Gene: ENSMUSG00000035126
AA Change: I104V

DomainStartEndE-ValueType
low complexity region 59 67 N/A INTRINSIC
low complexity region 76 100 N/A INTRINSIC
WD40 133 172 9.24e-4 SMART
WD40 182 229 5.7e1 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 262 296 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106868
AA Change: I427V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102481
Gene: ENSMUSG00000035126
AA Change: I427V

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 8.61e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
low complexity region 601 613 N/A INTRINSIC
Blast:WD40 614 648 3e-12 BLAST
WD40 652 692 2.38e-6 SMART
WD40 695 734 1.48e-2 SMART
WD40 739 779 6.14e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116316
AA Change: I427V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112018
Gene: ENSMUSG00000035126
AA Change: I427V

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138960
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Wdr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Wdr78 APN 4 103103242 missense possibly damaging 0.77
IGL01508:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01509:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01511:Wdr78 APN 4 103048361 missense possibly damaging 0.81
IGL01693:Wdr78 APN 4 103087330 splice site probably null
IGL01731:Wdr78 APN 4 103062435 missense probably benign 0.01
IGL02033:Wdr78 APN 4 103066293 missense possibly damaging 0.58
IGL02100:Wdr78 APN 4 103050149 missense probably damaging 1.00
IGL02218:Wdr78 APN 4 103096774 missense probably damaging 1.00
IGL02226:Wdr78 APN 4 103090398 missense probably benign 0.00
IGL02476:Wdr78 APN 4 103087348 missense possibly damaging 0.46
IGL02929:Wdr78 APN 4 103059991 nonsense probably null
R0070:Wdr78 UTSW 4 103059934 missense probably damaging 1.00
R0377:Wdr78 UTSW 4 103048259 missense probably damaging 1.00
R0433:Wdr78 UTSW 4 103103253 missense probably benign 0.41
R0518:Wdr78 UTSW 4 103064530 nonsense probably null
R0538:Wdr78 UTSW 4 103096618 missense possibly damaging 0.65
R0624:Wdr78 UTSW 4 103072857 splice site probably benign
R0894:Wdr78 UTSW 4 103049386 intron probably benign
R1463:Wdr78 UTSW 4 103087418 missense possibly damaging 0.95
R1818:Wdr78 UTSW 4 103072657 missense possibly damaging 0.67
R2073:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2075:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2851:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2852:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2853:Wdr78 UTSW 4 103050158 missense possibly damaging 0.90
R4491:Wdr78 UTSW 4 103066399 missense probably benign 0.04
R4792:Wdr78 UTSW 4 103072684 missense possibly damaging 0.94
R5223:Wdr78 UTSW 4 103049403 missense possibly damaging 0.87
R5290:Wdr78 UTSW 4 103049533 missense probably benign 0.00
R5465:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R5975:Wdr78 UTSW 4 103049589 missense probably benign 0.03
R6239:Wdr78 UTSW 4 103066443 missense probably benign
R6304:Wdr78 UTSW 4 103087356 missense probably benign 0.35
R6456:Wdr78 UTSW 4 103049549 missense probably benign 0.00
R6467:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R6813:Wdr78 UTSW 4 103048326 missense probably benign 0.26
R7161:Wdr78 UTSW 4 103096616 missense probably benign 0.28
R7198:Wdr78 UTSW 4 103062413 missense probably damaging 0.98
R7208:Wdr78 UTSW 4 103066352 missense probably benign 0.00
R7320:Wdr78 UTSW 4 103050187 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AATGAGAAACCCTGCCTCCG -3'
(R):5'- AAAGTTTCAGTAGGCTGGGGTC -3'

Sequencing Primer
(F):5'- ACTGAGTCATGACAGTTGTCC -3'
(R):5'- TGTAATGCCACTAAGTGTCAGG -3'
Posted On2014-11-12