Incidental Mutation 'R2436:Usp24'
ID249575
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106409645 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1875 (L1875*)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect probably null
Transcript: ENSMUST00000094933
AA Change: L1874*
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: L1874*

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165709
AA Change: L1875*
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: L1875*

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 intron probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7983:Usp24 UTSW 4 106409400 missense probably damaging 1.00
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGAAGGTATCGCACTTGCCC -3'
(R):5'- ATGCTGGTTTCAAGAGGACAG -3'

Sequencing Primer
(F):5'- GCCCTTTCCAAGAAACAGTGTTAGTG -3'
(R):5'- CTGGTTTCAAGAGGACAGAGGGC -3'
Posted On2014-11-12