Mutagenetix > Incidental Mutation

Incidental Mutation 'R2436:Card11'

249579

Institutional Source

Beutler Lab

Gene Symbol

Card11

Ensembl Gene

ENSMUSG00000036526

Gene Name

caspase recruitment domain family, member 11

Synonyms

2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik

MMRRC Submission

040397-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2436 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140858745-140986337 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 140868117 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 844 (V844M)

Ref Sequence

ENSEMBL: ENSMUSP00000082941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085786]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085786
AA Change: V844M

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: V844M

Domain	Start	End	E-Value	Type
Pfam:CARD	23	109	1.3e-23	PFAM
coiled coil region	176	440	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
low complexity region	535	549	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
PDZ	674	755	2.73e-1	SMART
Blast:SH3	776	838	1e-10	BLAST
low complexity region	839	850	N/A	INTRINSIC
low complexity region	920	934	N/A	INTRINSIC
SCOP:d1kjwa2	970	1149	1e-18	SMART
Blast:GuKc	973	1139	1e-102	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196169

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	G	16: 56,582,308 (GRCm39)	S277P	possibly damaging	Het
Arl6ip4	T	C	5: 124,254,662 (GRCm39)	S52P	probably benign	Het
Barx2	T	C	9: 31,824,383 (GRCm39)	H2R	probably damaging	Het
Calhm3	T	C	19: 47,140,404 (GRCm39)	T230A	probably damaging	Het
Dnah6	C	T	6: 73,126,156 (GRCm39)	R1327Q	probably benign	Het
Dnai4	T	C	4: 102,923,549 (GRCm39)	I427V	probably benign	Het
Ehbp1	C	A	11: 22,039,524 (GRCm39)		probably null	Het
Fgg	T	A	3: 82,921,496 (GRCm39)	I393N	possibly damaging	Het
Foxq1	A	T	13: 31,742,516 (GRCm39)		probably benign	Het
Hmgxb3	T	C	18: 61,280,566 (GRCm39)	T646A	probably benign	Het
Homer3	G	A	8: 70,745,706 (GRCm39)	E324K	possibly damaging	Het
Krt80	A	G	15: 101,257,384 (GRCm39)	F183L	probably damaging	Het
Map3k21	A	T	8: 126,668,354 (GRCm39)	K647*	probably null	Het
Mcm3ap	A	G	10: 76,325,891 (GRCm39)	Y1067C	probably damaging	Het
Myh1	G	T	11: 67,104,097 (GRCm39)	Q921H	probably benign	Het
Nme8	A	G	13: 19,862,029 (GRCm39)	F200S	probably damaging	Het
Nploc4	T	C	11: 120,309,143 (GRCm39)	N153S	possibly damaging	Het
Or14c45	T	C	7: 86,176,591 (GRCm39)	F209L	probably damaging	Het
Or2ak6	T	C	11: 58,592,952 (GRCm39)	C142R	probably damaging	Het
Or4a73	A	G	2: 89,421,117 (GRCm39)	V114A	probably benign	Het
Or5k1	C	T	16: 58,617,607 (GRCm39)	V201I	probably benign	Het
Pipox	T	A	11: 77,782,943 (GRCm39)	L86F	probably damaging	Het
Polr3h	G	T	15: 81,801,406 (GRCm39)	L157I	probably benign	Het
Prex2	G	A	1: 11,336,376 (GRCm39)	V1525M	possibly damaging	Het
Rapgef2	A	T	3: 78,996,079 (GRCm39)	D561E	possibly damaging	Het
Sacs	A	T	14: 61,440,354 (GRCm39)	D800V	possibly damaging	Het
Sbsn	A	T	7: 30,451,655 (GRCm39)	L223F	possibly damaging	Het
Slc16a9	TCCCC	TCCCCC	10: 70,091,911 (GRCm39)		probably null	Het
Srrm3	G	T	5: 135,864,030 (GRCm39)	E43*	probably null	Het
Tcaf3	G	A	6: 42,570,663 (GRCm39)	A363V	probably damaging	Het
Tmem138	A	G	19: 10,552,268 (GRCm39)	F78S	probably damaging	Het
Tnfrsf17	G	A	16: 11,137,676 (GRCm39)	D138N	probably damaging	Het
Tubgcp6	C	T	15: 88,986,568 (GRCm39)	V1344I	probably benign	Het
Usp24	T	A	4: 106,266,842 (GRCm39)	L1875*	probably null	Het
Vmn2r109	C	A	17: 20,774,798 (GRCm39)	G186C	probably damaging	Het
Zfp541	A	G	7: 15,810,373 (GRCm39)	N137D	possibly damaging	Het

Other mutations in Card11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
unmodulated	APN	5	140,897,997 (GRCm38)	intron	probably benign
IGL00961:Card11	APN	5	140,885,464 (GRCm39)	missense	probably damaging	0.97
IGL01645:Card11	APN	5	140,863,778 (GRCm39)	missense	probably benign	0.00
IGL01731:Card11	APN	5	140,868,057 (GRCm39)	missense	possibly damaging	0.89
IGL01782:Card11	APN	5	140,913,481 (GRCm39)	start codon destroyed	probably null	0.02
IGL01935:Card11	APN	5	140,869,301 (GRCm39)	missense	possibly damaging	0.62
IGL01991:Card11	APN	5	140,899,133 (GRCm39)	missense	possibly damaging	0.63
IGL02447:Card11	APN	5	140,892,679 (GRCm39)	missense	possibly damaging	0.93
IGL02583:Card11	APN	5	140,863,881 (GRCm39)	missense	probably benign	0.10
IGL03255:Card11	APN	5	140,884,086 (GRCm39)	missense	possibly damaging	0.73
Ace	UTSW	5	140,888,632 (GRCm39)	missense	possibly damaging	0.70
Caravaggio	UTSW	5	140,899,064 (GRCm39)	missense	probably damaging	1.00
Dealer	UTSW	5	140,871,632 (GRCm39)	missense	probably damaging	1.00
Dogs	UTSW	5	140,867,755 (GRCm39)	critical splice donor site	probably null
Face	UTSW	5	140,886,732 (GRCm39)	missense	probably damaging	1.00
hubei	UTSW	5	140,892,522 (GRCm39)	missense	probably damaging	0.96
king	UTSW	5	140,876,835 (GRCm39)	splice site	probably benign
may	UTSW	5	140,862,250 (GRCm39)	nonsense	probably null
Poker	UTSW	5	140,863,837 (GRCm39)	missense	probably benign
Sharp	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
Tumnus	UTSW	5	140,871,700 (GRCm39)	missense	possibly damaging	0.75
unmodulated2	UTSW	5	140,869,537 (GRCm39)	splice site	probably null
PIT4243001:Card11	UTSW	5	140,894,359 (GRCm39)	missense	possibly damaging	0.95
PIT4486001:Card11	UTSW	5	140,862,163 (GRCm39)	missense	probably damaging	1.00
PIT4531001:Card11	UTSW	5	140,892,415 (GRCm39)	missense	probably damaging	0.99
R0046:Card11	UTSW	5	140,894,279 (GRCm39)	missense	possibly damaging	0.92
R0285:Card11	UTSW	5	140,872,856 (GRCm39)	missense	probably damaging	1.00
R0452:Card11	UTSW	5	140,866,125 (GRCm39)	missense	probably benign	0.01
R1486:Card11	UTSW	5	140,862,274 (GRCm39)	missense	probably benign
R1710:Card11	UTSW	5	140,888,660 (GRCm39)	nonsense	probably null
R1733:Card11	UTSW	5	140,892,388 (GRCm39)	missense	possibly damaging	0.88
R1817:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R1818:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R2027:Card11	UTSW	5	140,892,522 (GRCm39)	missense	probably damaging	0.96
R2904:Card11	UTSW	5	140,874,888 (GRCm39)	missense	probably benign	0.09
R3706:Card11	UTSW	5	140,872,890 (GRCm39)	missense	probably damaging	0.99
R3708:Card11	UTSW	5	140,872,890 (GRCm39)	missense	probably damaging	0.99
R4778:Card11	UTSW	5	140,869,537 (GRCm39)	splice site	probably null
R4877:Card11	UTSW	5	140,871,632 (GRCm39)	missense	probably damaging	1.00
R4889:Card11	UTSW	5	140,871,700 (GRCm39)	missense	possibly damaging	0.75
R4910:Card11	UTSW	5	140,860,169 (GRCm39)	missense	probably damaging	1.00
R5011:Card11	UTSW	5	140,862,275 (GRCm39)	missense	possibly damaging	0.93
R5257:Card11	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
R5258:Card11	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
R5682:Card11	UTSW	5	140,888,666 (GRCm39)	nonsense	probably null
R5754:Card11	UTSW	5	140,885,524 (GRCm39)	missense	probably damaging	0.99
R5873:Card11	UTSW	5	140,894,393 (GRCm39)	missense	probably damaging	1.00
R6184:Card11	UTSW	5	140,884,033 (GRCm39)	missense	probably damaging	1.00
R6792:Card11	UTSW	5	140,899,064 (GRCm39)	missense	probably damaging	1.00
R6825:Card11	UTSW	5	140,863,837 (GRCm39)	missense	probably benign
R7008:Card11	UTSW	5	140,859,148 (GRCm39)	missense	probably damaging	1.00
R7291:Card11	UTSW	5	140,886,825 (GRCm39)	missense	probably damaging	1.00
R7376:Card11	UTSW	5	140,883,993 (GRCm39)	missense	probably benign	0.01
R7526:Card11	UTSW	5	140,899,184 (GRCm39)	splice site	probably null
R7683:Card11	UTSW	5	140,881,781 (GRCm39)	missense	probably benign
R7730:Card11	UTSW	5	140,871,751 (GRCm39)	missense	probably damaging	0.96
R7813:Card11	UTSW	5	140,885,419 (GRCm39)	missense	probably damaging	1.00
R7831:Card11	UTSW	5	140,859,167 (GRCm39)	missense	possibly damaging	0.61
R7911:Card11	UTSW	5	140,867,755 (GRCm39)	critical splice donor site	probably null
R8154:Card11	UTSW	5	140,886,732 (GRCm39)	missense	probably damaging	1.00
R8224:Card11	UTSW	5	140,888,632 (GRCm39)	missense	possibly damaging	0.70
R8272:Card11	UTSW	5	140,875,794 (GRCm39)	missense	probably damaging	1.00
R8714:Card11	UTSW	5	140,899,147 (GRCm39)	missense	possibly damaging	0.67
R8715:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R9065:Card11	UTSW	5	140,894,297 (GRCm39)	missense	probably damaging	1.00
R9211:Card11	UTSW	5	140,869,375 (GRCm39)	missense	probably benign	0.16
R9215:Card11	UTSW	5	140,866,154 (GRCm39)	missense	possibly damaging	0.64
R9269:Card11	UTSW	5	140,892,516 (GRCm39)	missense	probably damaging	0.99
R9385:Card11	UTSW	5	140,871,276 (GRCm39)	missense	probably benign	0.44
R9421:Card11	UTSW	5	140,869,462 (GRCm39)	missense	probably damaging	0.97
R9424:Card11	UTSW	5	140,894,395 (GRCm39)	missense	probably damaging	1.00
R9444:Card11	UTSW	5	140,894,393 (GRCm39)	missense	probably damaging	1.00
V7732:Card11	UTSW	5	140,862,250 (GRCm39)	nonsense	probably null
X0067:Card11	UTSW	5	140,871,347 (GRCm39)	missense	possibly damaging	0.60
Z1177:Card11	UTSW	5	140,883,996 (GRCm39)	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- ACTGCGGTAGAGAGATGTCC -3'
(R):5'- CAGATGGTCAGTGAAGAAACCC -3'

Sequencing Primer
(F):5'- TAGAGAGATGTCCGTCCATCC -3'
(R):5'- TGGTCAGTGAAGAAACCCAGACAC -3'

Posted On

2014-11-12