Incidental Mutation 'R2436:Tcaf3'
ID 249580
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2436 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 42593729 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 363 (A363V)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: A363V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: A363V

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAATTGAGACAGGGCTCTCC -3'
(R):5'- CTTTACACTGGCTGATGGGG -3'

Sequencing Primer
(F):5'- CCGAAAGTGATAGTTTGTCCCTTCAG -3'
(R):5'- ACAGGCAGAATTGGGTTAGCTTC -3'
Posted On 2014-11-12