Mutagenetix > Incidental Mutation

Incidental Mutation 'R2436:Homer3'

249586

Institutional Source

Beutler Lab

Gene Symbol

Homer3

Ensembl Gene

ENSMUSG00000003573

Gene Name

homer scaffolding protein 3

Synonyms

MMRRC Submission

040397-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R2436 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

70282827-70294361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70293056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 324 (E324K)

Ref Sequence

ENSEMBL: ENSMUSP00000105751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000110124] [ENSMUST00000140212]

AlphaFold

Q99JP6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003669
AA Change: E324K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: E324K

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000008004

SMART Domains

Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

Domain	Start	End	E-Value	Type
DEXDc	21	222	1.85e-57	SMART
HELICc	262	343	2.41e-29	SMART
low complexity region	369	383	N/A	INTRINSIC
low complexity region	461	470	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110124
AA Change: E324K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: E324K

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	285	342	2e-10	PDB
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127094

Predicted Effect

unknown
Transcript: ENSMUST00000135368
AA Change: E57K

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138688

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140212
AA Change: E321K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: E321K

Domain	Start	End	E-Value	Type
WH1	4	110	4.92e-37	SMART
low complexity region	198	210	N/A	INTRINSIC
PDB:3CVF\|D	282	339	2e-10	PDB
low complexity region	340	355	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144890

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	G	16: 56,761,945	S277P	possibly damaging	Het
Arl6ip4	T	C	5: 124,116,599	S52P	probably benign	Het
Barx2	T	C	9: 31,913,087	H2R	probably damaging	Het
Calhm3	T	C	19: 47,151,965	T230A	probably damaging	Het
Card11	C	T	5: 140,882,362	V844M	possibly damaging	Het
Dnah6	C	T	6: 73,149,173	R1327Q	probably benign	Het
Ehbp1	C	A	11: 22,089,524		probably null	Het
Fgg	T	A	3: 83,014,189	I393N	possibly damaging	Het
Foxq1	A	T	13: 31,558,533		probably benign	Het
Hmgxb3	T	C	18: 61,147,494	T646A	probably benign	Het
Krt80	A	G	15: 101,359,503	F183L	probably damaging	Het
Map3k21	A	T	8: 125,941,615	K647*	probably null	Het
Mcm3ap	A	G	10: 76,490,057	Y1067C	probably damaging	Het
Myh1	G	T	11: 67,213,271	Q921H	probably benign	Het
Nme8	A	G	13: 19,677,859	F200S	probably damaging	Het
Nploc4	T	C	11: 120,418,317	N153S	possibly damaging	Het
Olfr1246	A	G	2: 89,590,773	V114A	probably benign	Het
Olfr173	C	T	16: 58,797,244	V201I	probably benign	Het
Olfr297	T	C	7: 86,527,383	F209L	probably damaging	Het
Olfr319	T	C	11: 58,702,126	C142R	probably damaging	Het
Pipox	T	A	11: 77,892,117	L86F	probably damaging	Het
Polr3h	G	T	15: 81,917,205	L157I	probably benign	Het
Prex2	G	A	1: 11,266,152	V1525M	possibly damaging	Het
Rapgef2	A	T	3: 79,088,772	D561E	possibly damaging	Het
Sacs	A	T	14: 61,202,905	D800V	possibly damaging	Het
Sbsn	A	T	7: 30,752,230	L223F	possibly damaging	Het
Slc16a9	TCCCC	TCCCCC	10: 70,256,081		probably null	Het
Srrm3	G	T	5: 135,835,176	E43*	probably null	Het
Tcaf3	G	A	6: 42,593,729	A363V	probably damaging	Het
Tmem138	A	G	19: 10,574,904	F78S	probably damaging	Het
Tnfrsf17	G	A	16: 11,319,812	D138N	probably damaging	Het
Tubgcp6	C	T	15: 89,102,365	V1344I	probably benign	Het
Usp24	T	A	4: 106,409,645	L1875*	probably null	Het
Vmn2r109	C	A	17: 20,554,536	G186C	probably damaging	Het
Wdr78	T	C	4: 103,066,352	I427V	probably benign	Het
Zfp541	A	G	7: 16,076,448	N137D	possibly damaging	Het

Other mutations in Homer3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01966:Homer3	APN	8	70290157	missense	probably damaging	0.96
IGL02493:Homer3	APN	8	70290071	missense	probably benign	0.00
IGL03134:Homer3	UTSW	8	70286335	missense	probably benign	0.00
R3508:Homer3	UTSW	8	70291355	missense	probably benign	0.06
R4391:Homer3	UTSW	8	70290143	splice site	probably null
R4392:Homer3	UTSW	8	70290143	splice site	probably null
R4395:Homer3	UTSW	8	70290143	splice site	probably null
R4396:Homer3	UTSW	8	70290143	splice site	probably null
R4397:Homer3	UTSW	8	70290143	splice site	probably null
R4401:Homer3	UTSW	8	70290143	splice site	probably null
R4402:Homer3	UTSW	8	70290143	splice site	probably null
R4445:Homer3	UTSW	8	70290143	splice site	probably null
R4446:Homer3	UTSW	8	70290143	splice site	probably null
R4482:Homer3	UTSW	8	70290143	splice site	probably null
R4488:Homer3	UTSW	8	70290143	splice site	probably null
R4489:Homer3	UTSW	8	70290143	splice site	probably null
R4664:Homer3	UTSW	8	70290143	splice site	probably null
R4666:Homer3	UTSW	8	70290143	splice site	probably null
R4751:Homer3	UTSW	8	70285434	missense	probably damaging	1.00
R5071:Homer3	UTSW	8	70291355	missense	probably benign
R5828:Homer3	UTSW	8	70286306	missense	probably benign	0.02
R6052:Homer3	UTSW	8	70291426	nonsense	probably null
R6211:Homer3	UTSW	8	70285524	missense	probably damaging	1.00
R6234:Homer3	UTSW	8	70291165	critical splice donor site	probably null
R6895:Homer3	UTSW	8	70285305	missense	probably damaging	0.99
R6914:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R6942:Homer3	UTSW	8	70291551	missense	probably benign	0.00
R7300:Homer3	UTSW	8	70285303	start codon destroyed	probably null	0.23
R7391:Homer3	UTSW	8	70289484	missense	probably benign	0.00
R7553:Homer3	UTSW	8	70290124	missense	probably benign	0.02
R7555:Homer3	UTSW	8	70289413	missense	probably damaging	1.00
R7721:Homer3	UTSW	8	70291012	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACATGTGTGGTATTGTACACCAG -3'
(R):5'- GCAAAGCTCAGAGACAGCTG -3'

Sequencing Primer
(F):5'- CAGTGGGATTACAAATGCTTGCC -3'
(R):5'- TCAGAGACAGCTGGGGTC -3'

Posted On

2014-11-12