Incidental Mutation 'R2436:Barx2'
ID249589
Institutional Source Beutler Lab
Gene Symbol Barx2
Ensembl Gene ENSMUSG00000032033
Gene NameBarH-like homeobox 2
Synonyms2310006E12Rik, Barx2b
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R2436 (G1)
Quality Score217
Status Not validated
Chromosome9
Chromosomal Location31846044-31913462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31913087 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 2 (H2R)
Ref Sequence ENSEMBL: ENSMUSP00000112314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116615]
Predicted Effect probably damaging
Transcript: ENSMUST00000116615
AA Change: H2R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112314
Gene: ENSMUSG00000032033
AA Change: H2R

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
HOX 137 199 3.2e-25 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 268 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216981
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted gene deletion exhibit short whiskers at birth, defective juvenile hair follicle remodeling, and short adult hair. Fifty percent of homozygotes are born with open eyelids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Barx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Barx2 APN 9 31846845 missense unknown
IGL02045:Barx2 APN 9 31858798 missense probably damaging 1.00
IGL03341:Barx2 APN 9 31858794 missense probably damaging 1.00
R1401:Barx2 UTSW 9 31859031 missense probably damaging 1.00
R1982:Barx2 UTSW 9 31913012 missense probably damaging 1.00
R4543:Barx2 UTSW 9 31846796 missense unknown
R4804:Barx2 UTSW 9 31846812 missense unknown
R5399:Barx2 UTSW 9 31854111 critical splice donor site probably null
R5436:Barx2 UTSW 9 31912989 missense probably damaging 1.00
R5700:Barx2 UTSW 9 31858765 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6042:Barx2 UTSW 9 31846903 missense probably benign 0.35
R6533:Barx2 UTSW 9 31912979 missense probably damaging 1.00
R6618:Barx2 UTSW 9 31846872 missense probably benign 0.01
Z1088:Barx2 UTSW 9 31846866 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTACCGGTACAAGAGTGCAGGG -3'
(R):5'- GCTGTAGTCAAAGATGCTGC -3'

Sequencing Primer
(F):5'- TACAAGAGTGCAGGGGCTTG -3'
(R):5'- TAGTCAAAGATGCTGCTCGGC -3'
Posted On2014-11-12