Incidental Mutation 'R2436:Slc16a9'
ID249591
Institutional Source Beutler Lab
Gene Symbol Slc16a9
Ensembl Gene ENSMUSG00000037762
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 9
Synonyms1200003C15Rik, 4930425B13Rik
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2436 (G1)
Quality Score167
Status Not validated
Chromosome10
Chromosomal Location70245100-70285968 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCCC to TCCCCC at 70256081 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046807]
Predicted Effect probably null
Transcript: ENSMUST00000046807
SMART Domains Protein: ENSMUSP00000047912
Gene: ENSMUSG00000037762

DomainStartEndE-ValueType
Pfam:MFS_1 15 319 6.5e-17 PFAM
Pfam:MFS_1 303 500 1.2e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Slc16a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Slc16a9 APN 10 70282699 missense probably benign 0.04
IGL01725:Slc16a9 APN 10 70283985 missense probably benign
IGL02963:Slc16a9 APN 10 70267136 missense probably damaging 1.00
PIT4810001:Slc16a9 UTSW 10 70283932 nonsense probably null
R1301:Slc16a9 UTSW 10 70282478 missense probably benign 0.07
R4036:Slc16a9 UTSW 10 70274956 missense probably damaging 1.00
R4591:Slc16a9 UTSW 10 70282880 missense probably damaging 1.00
R5377:Slc16a9 UTSW 10 70283128 missense probably damaging 1.00
R5868:Slc16a9 UTSW 10 70282490 missense probably benign 0.01
R7313:Slc16a9 UTSW 10 70283170 missense probably damaging 1.00
Z1176:Slc16a9 UTSW 10 70284026 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GAAAGAGGTATTTTATCCCGAACTCTG -3'
(R):5'- AAGCCTTCCATGCTCTGTACG -3'

Sequencing Primer
(F):5'- GGTATTTTATCCCGAACTCTGTACTC -3'
(R):5'- CTCTGTACGGTATCAATGACACGG -3'
Posted On2014-11-12