Incidental Mutation 'R2436:Nme8'
ID249598
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene NameNME/NM23 family member 8
SynonymsSptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location19645078-19697794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19677859 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 200 (F200S)
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763] [ENSMUST00000223466]
Predicted Effect probably damaging
Transcript: ENSMUST00000039340
AA Change: F200S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: F200S

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091763
AA Change: F200S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: F200S

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223286
Predicted Effect probably benign
Transcript: ENSMUST00000223466
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTGTGGACATCTTCAAGACACC -3'
(R):5'- GAGCCACTTTAAACCATGTGG -3'

Sequencing Primer
(F):5'- AGACACCAAAATTTATTCAATTGGC -3'
(R):5'- GCCACTTTAAACCATGTGGATTTTC -3'
Posted On2014-11-12