Incidental Mutation 'R2436:Adgrg7'
ID249604
Institutional Source Beutler Lab
Gene Symbol Adgrg7
Ensembl Gene ENSMUSG00000022755
Gene Nameadhesion G protein-coupled receptor G7
SynonymsGpr128, 9130020O16Rik
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location56724609-56795855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56761945 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 277 (S277P)
Ref Sequence ENSEMBL: ENSMUSP00000023437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023437
AA Change: S277P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023437
Gene: ENSMUSG00000022755
AA Change: S277P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
SCOP:d1edmb_ 52 76 1e-3 SMART
GPS 376 424 6.16e-8 SMART
Pfam:7tm_2 428 712 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120470
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight gain and increased frequency of peristalsis and slow wave potential in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Adgrg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Adgrg7 APN 16 56747919 critical splice donor site probably null
IGL03122:Adgrg7 APN 16 56770362 splice site probably benign
R0632:Adgrg7 UTSW 16 56742589 missense possibly damaging 0.89
R0673:Adgrg7 UTSW 16 56773486 missense possibly damaging 0.48
R1690:Adgrg7 UTSW 16 56795630 missense probably damaging 0.99
R2009:Adgrg7 UTSW 16 56761873 missense probably benign 0.08
R2017:Adgrg7 UTSW 16 56732806 missense probably benign 0.02
R2132:Adgrg7 UTSW 16 56767918 missense probably damaging 1.00
R2153:Adgrg7 UTSW 16 56752428 missense possibly damaging 0.75
R2229:Adgrg7 UTSW 16 56752403 missense probably benign
R2878:Adgrg7 UTSW 16 56750454 missense probably benign 0.14
R2981:Adgrg7 UTSW 16 56750406 critical splice donor site probably null
R4014:Adgrg7 UTSW 16 56742288 missense probably damaging 1.00
R4023:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4024:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4026:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4551:Adgrg7 UTSW 16 56748012 missense probably damaging 1.00
R4834:Adgrg7 UTSW 16 56732869 missense probably damaging 1.00
R5041:Adgrg7 UTSW 16 56730348 missense probably benign 0.21
R5145:Adgrg7 UTSW 16 56742319 missense probably benign 0.04
R5377:Adgrg7 UTSW 16 56730306 missense possibly damaging 0.68
R5549:Adgrg7 UTSW 16 56750427 missense probably damaging 1.00
R5915:Adgrg7 UTSW 16 56730385 splice site probably null
R5957:Adgrg7 UTSW 16 56773427 missense probably damaging 0.96
R6146:Adgrg7 UTSW 16 56773466 missense probably benign 0.21
R6198:Adgrg7 UTSW 16 56777193 missense possibly damaging 0.64
R6233:Adgrg7 UTSW 16 56778642 missense possibly damaging 0.52
R6337:Adgrg7 UTSW 16 56752425 missense probably damaging 0.96
R6633:Adgrg7 UTSW 16 56730286 missense probably benign 0.05
R6693:Adgrg7 UTSW 16 56770224 missense probably damaging 0.97
R6812:Adgrg7 UTSW 16 56795798 start gained probably benign
R6841:Adgrg7 UTSW 16 56750424 missense probably damaging 1.00
R6868:Adgrg7 UTSW 16 56773476 missense probably benign
R7076:Adgrg7 UTSW 16 56742406 missense probably damaging 1.00
R7146:Adgrg7 UTSW 16 56730242 missense probably damaging 1.00
R7232:Adgrg7 UTSW 16 56777152 synonymous probably null
R7266:Adgrg7 UTSW 16 56770311 missense probably benign 0.00
R7376:Adgrg7 UTSW 16 56724979 missense probably damaging 1.00
R7390:Adgrg7 UTSW 16 56732844 missense probably damaging 0.98
R7401:Adgrg7 UTSW 16 56742418 missense probably benign 0.43
R7496:Adgrg7 UTSW 16 56732857 missense probably benign
R7540:Adgrg7 UTSW 16 56750429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCATCAGAGCCTAAAGAC -3'
(R):5'- ATAGCAATCCAGTCCGTCACTC -3'

Sequencing Primer
(F):5'- TTCCCTTCATGGACTTTTAAGTTAG -3'
(R):5'- GTCACTCGAGACGACAATTCAGG -3'
Posted On2014-11-12